Cxcl10 (NM_139089) Rat Untagged Clone

CAT#: RN213276

Cxcl10 (untagged ORF) - Rat chemokine (C-X-C motif) ligand 10 (Cxcl10), (10 ug)


  "NM_139089" in other vectors (3)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cxcl10"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Cxcl10
Synonyms IP-10; Scyb10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN213276 representing NM_139089
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACCCAAGTGCTGCTGTCGTTCTCTGCCTCGTGCTGCTGAGTCTGAGTGGGACTCAAGGGATCCCTC
TCGCAAGAACGGTGCGCTGCACCTGCATCGACTTCCATGAACAGACGCTGAGACCCAGGGCCATAGGAAA
ACTTGAAATCATTCCTGCAAGTCTATCCTGTCCGCATGTTGAGATCATTGCCACAATGAAGAAGAACAAT
GAGAAGAGGTGTCTGAATCCGGAATCTGAGGCCATCAAGAGCTTATTGAAAGCGGTGAGCCAAAGAAGGT
CAAAAAGAGCTCCGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_139089
ORF Size 297 bp
Insert Size 297
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_139089.1, NP_620789.1
RefSeq Size 1133
RefSeq ORF 297
Locus ID 245920
Gene Summary induces DNA synthesis, cell proliferation, and cell migration in vascular smooth muscle cells; may play a role in vascular remodeling [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.