Ccl22 (NM_057203) Rat Untagged Clone

CAT#: RN213436

Ccl22 (untagged ORF) - Rat chemokine (C-C motif) ligand 22 (Ccl22), (10 ug)


  "NM_057203" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ccl22"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Ccl22
Synonyms Mdc; Scya22
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN213436 representing NM_057203
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCAGCCTGCGAGTCCCACTCCTGGTGGCTCTCGTCCTTCTTGCTGTGGCACTTCAGACCTCCGATG
CAGGTCCCTATGGTGCCAATGTGGAAGACAGTATCTGCTGCCAGGACTACATCCGTCACCCTCTGCCACC
ACGTTTCGTGAAGGAGTTCTACTGGACCTCAAAGTCCTGCCGCAAGCCTGGCGTCGTTTTGATAACCATC
AAGAACCGAGATATCTGTGCTGACCCCAGGATGCTCTGGGTGAAGAAGATACTCCACAAGTTGGCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_057203
ORF Size 279 bp
Insert Size 279
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_057203.1, NP_476551.1
RefSeq Size 1770
RefSeq ORF 279
Locus ID 117551
Gene Summary chemoattractant for dendritic cells, natural killer (NK) cells, and the Th2 subset of peripheral blood T cells [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.