Rpl39 (NM_012875) Rat Untagged Clone

CAT#: RN213559

Rpl39 (untagged ORF) - Rat ribosomal protein L39 (Rpl39), (10 ug)


  "NM_012875" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Rpl39"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Rpl39
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN213559 representing NM_012875
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTTCTCACAAGACTTTCAGAATCAAGCGATTCCTGGCAAAGAAACAAAAGCAAAATCGTCCTATTC
CTCAATGGATTCGGATGAAAACTGGTAACAAAATCAGGTACAACTCTAAGAGAAGACACTGGAGGAGAAC
GAAGCTGGGTCTATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_012875
ORF Size 156 bp
Insert Size 156
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_012875.2, NP_037007.1
RefSeq Size 323
RefSeq ORF 156
Locus ID 25347
Gene Summary a component of the ribosome [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.