Selenos (NM_173120) Rat Untagged Clone

CAT#: RN213574

Vimp (untagged ORF) - Rat selenoprotein S (Sels), (Note, selenocysteine protein, internal stop codon, see reference data summary)


  "NM_173120" in other vectors (3)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "Selenos"

Specifications

Product Data
Type Rat Untagged Clone
Symbol Selenos
Synonyms Sels; sg2; Vimp
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN213574 representing NM_173120
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATCGCGGGGAGGAACCTCTGTCCGCGAGGCCGGCGCTGGAGACCGAGAGCCTGCGATTCCTGCACG
TCACAGTGGGCTCCCTGCTGGCCAGCTATGGCTGGTACATCCTCTTCAGCTGCGTCCTTCTCTACATTGT
CATCCAGAAGCTCTCCCTGCGACTGAGGGCTTTAAGGCAGAGGCAGCTGGACCAAGCTGAGGCTGTTCTG
GAGCCTGATGTTGTTGTTAAGCGACAAGAGGCTTTAGCAGCTGCTCGTTTGAGAATGCAGGAAGATCTGA
ATGCCCAAGTTGAAAAACATAAGGAAAAACTAAGACAGCTTGAAGAAGAGAAAAGGAGACAGAAGATTGA
AATGTGGGACAGCATGCAAGAAGGCAGAAGTTACAAAAGAAACTCAGGAAGGCCTCAGGAAGAAGATGGT
CCTGGACCTTCTACTTCATCGGTCATCCCCAAAGGAAAATCTGACAAAAAGCCTTTACGGGGAGGTGGTT
ATAACCCTCTGACAGGTGAAGGGGGTGGAACCTGCTCCTGGAGACCTGGACGCAGGGGCCCATCATCTGG
TGGATGAAGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_173120
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
Reference Data
RefSeq NM_173120.2, NP_775143.2
RefSeq Size 1173
RefSeq ORF 573
Locus ID 286900
Gene Summary This gene encodes a transmembrane protein that is localized in the endoplasmic reticulum (ER). It is involved in the degradation process of misfolded proteins in the ER, and may also have a role in inflammation control. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Two additional phylogenetically conserved stem-loop structures (Stem-loop 1 and Stem-loop 2) in the 3' UTR of this mRNA have been shown to function as modulators of Sec insertion (PMID:23614019). [provided by RefSeq, Jul 2017]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.