Timm8a1 (NM_053370) Rat Untagged Clone

CAT#: RN213665

Timm8a1 (untagged ORF) - Rat translocase of inner mitochondrial membrane 8 homolog a1 (yeast) (Timm8a1), nuclear gene encoding mitochondrial protein, (10 ug)


  "NM_053370" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Timm8a1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Timm8a1
Synonyms DDP; Ddp1; Timm8a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN213665 representing NM_053370
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGTCCTCCTCGTCCTCTTCGGGCTCGGCTTTGGCCGCCGTGGACCCTCAGCTGCAGCATTTCATCG
AGGTGGAGACACAGAAGCAGCGCTTCCAGCAGCTGGTGCACCAGATGACGGAACTTTGCTGGGAGAAGTG
CATGGATAAGCCTGGGCCTAAGTTGGACAGTCGGGCTGAGGCCTGTTTTGTGAACTGCGTTGAACGCTTC
ATTGATACAAGCCAGTTCATCTTAAATCGACTGGAGCAGACCCAGAAGTCCAAACCTGTCTTCTCAGAAA
GCCTTTCTGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_053370
ORF Size 294 bp
Insert Size 294
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_053370.3, NP_445822.1
RefSeq Size 1275
RefSeq ORF 294
Locus ID 84383
Gene Summary mediates mitochondrial protein import; may play a role in cell signaling and endosomal trafficking; deletion in human homolog causes X-linked degenerative dystonia, Mohr-Tranebjaerg-Jensen deafness-dystonia-optic atrophysyndrome [RGD, Jun 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.