Selenof (NM_133297) Rat Untagged Clone

CAT#: RN213906

41532 (untagged ORF) - Rat selenoprotein (Sep15), (Note, selenocysteine protein, internal stop codon, see reference data summary)

Specifications

Product Data

• Type: Rat Untagged Clone
• Symbol: Selenof
• Synonyms: Sep15
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN213906 representing NM_133297
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGGCAGGGCAGGGCGGGTGGCTCCGGCCCGCGCTGGGGCTTCGCTTACTGCTGGCGACTGCGTTTC
  AAGCGGTGTCTGCTCTTGGGGCAGAGTTCTCGTCAGAGGCATGCCGGGAGTTGGGCTTCTCCAGCAACTT
  GCTCTGCAGCTCCTGCGATCTCCTTGGACAGTTTAACCTGCTTCCACTGGATCCTGTCTGCAGAGGCTGC
  TGTCAGGAAGAAGCGCAGTTTGAAACCAAAAAGCTGTATGCAGGAGCCATCCTTGAAGTCTGTGGATGAA
  AATTGGGGAGGTTCCCTCAAGTCCAAGCTTTTGTCAGAAGCGATAAACCCAAACTGTTCAGAGGTCTACA
  GATCAAGTATGTTCGAGGCTCAGACCCTGTACTAAAGCTTTTGGACGACAACGGGAACATTGCTGAAGAG
  CTCAGCATCCTCAAGTGGAACACAGACAGTGTGGAAGAGTTCCTGAGCGAGAAGCTGGAACGCATATAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_133297
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.

Reference Data

• RefSeq: NM_133297.2, NP_579831.2
• RefSeq Size: 1537
• RefSeq ORF: 489
• Locus ID: 113922
• Gene Summary: The protein encoded by this gene belongs to the SEP15/selenoprotein M family. The exact function of this protein is not known; however, it has been found to associate with UDP-glucose:glycoprotein glucosyltransferase (UGTR), an endoplasmic reticulum(ER)-resident protein, which is involved in the quality control of protein folding. The association with UGTR retains this protein in the ER, where it may play a role in protein folding. Knockout studies in mice also suggest a role for this gene in cataract formation and colon carcinogenesis. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. [provided by RefSeq, Nov 2016]