Nop10 (NM_001126100) Rat Untagged Clone

CAT#: RN213924

Nop10 (untagged ORF) - Rat nucleolar protein family A, member 3 (Nola3), (10 ug)


  "NM_001126100" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Nop10"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Nop10
Synonyms Nola3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN213924 representing NM_001126100
Red=Cloning site Blue=ORF Orange=Stop codon

CTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCGGCGC
GCC
C

ATGTTTCTCCAGTATTACCTCAACGAGCAGGGCGATCGCGTCTATACTCTAAAGAAATTTGACCCCATGG
GACAACAGACTTGCTCTGCCCATCCTGCTCGGTTCTCCCCAGATGACAAATACTCAAGACACCGAATCAC
CATCAAGAAACGCTTCAAGGTGCTCATGACCCAGCAACCGCGACCTGTCCTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites AscI-MluI     
ACCN NM_001126100
ORF Size 195 bp
Insert Size 195
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001126100.1, NP_001119572.1
RefSeq Size 858
RefSeq ORF 195
Locus ID 691534

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.