Lenep (NM_053614) Rat Untagged Clone

CAT#: RN214193

Lenep (untagged ORF) - Rat lens epithelial protein (Lenep), (10 ug)


  "NM_053614" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Lenep"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Lenep
Synonyms Elp; Lep503
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN214193 representing NM_053614
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGCCACCGATGCAGCCCCTGACCCAGGCCCTGCCCTTCTCTCTGAGAGATGCCCTTCAAGGCACTG
GTCTCCGCGTGCCTGTCATTAAGATGGGCACAGGGTGGGAGGGCATGTATCGAACCCTGAAGGAAGTCGC
CCACATCCTTCTTTGTTGCTGGTGTATCAAGGAACTGCTGGATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_053614
ORF Size 186 bp
Insert Size 186
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_053614.1, NP_446066.1
RefSeq Size 593
RefSeq ORF 186
Locus ID 113917
Gene Summary lens epithelial cell gene; may be involved in lens epithelial cell differentiation [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.