Apoc3 (NM_012501) Rat Untagged Clone

CAT#: RN214203

Apoc3 (untagged ORF) - Rat apolipoprotein C-III (Apoc3), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Apoc3
• Synonyms: apo-CIII; ApoC-III
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN214203 representing NM_012501
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGCAGCCCCGAATGCTCCTCATCGTGGCCCTCGTGGCTCTCCTGGCCTCTGCCCGAGCTGATGAGGGAG
  AGGGATCCTTGCTGCTGGGCTCTATGCAGGGCTACATGGAACAAGCCTCCAAGACGGTCCAGGATGCACT
  AAGCAGCATGCAGGAGTCTGATATAGCTGTGGTGGCCAGGGGCTGGATGGACAATCGCTTCAAATCCCTG
  AAAGGCTACTGGAGCAAGTTCACTGATAAGTTCACTGGCCTCTGGGAGTCTGGCCCTGAGGACCAACTAA
  CAACACCAACTCTTGAGCCGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_012501
• ORF Size: 303 bp
• Insert Size: 303
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_012501.2, NP_036633.2
• RefSeq Size: 536
• RefSeq ORF: 303
• Locus ID: 24207
• Gene Summary: very low density lipoprotein (VLDL) that comprises a major component of the lipid transport system; increased levels induce hypertriglyceridemia [RGD, Feb 2006]
  Transcript Variant: This variant (1) represents the predominant transcript. Variants 1 and 2 both encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.