Ppid (NM_001004279) Rat Untagged Clone

CAT#: RN214228

Ppid (untagged ORF) - Rat peptidylprolyl isomerase D (cyclophilin D) (Ppid), (10 ug)


  "NM_001004279" in other vectors (5)

Reconstitution Protocol

USD 420.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ppid"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Ppid
Synonyms Cyp-40; CypD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN214228 representing NM_001004279
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCCACCCATCCCCAGCAGGCAAGCCCTCCAATTCCAAGAACCCGCGAGTCTTCTTTGACGTGGACA
TCGGCGGGGAGCGAGTTGGACGAATTGTTTTAGAATTGTTTGCAGATATTGTTCCTAAAACTGCAGAAAA
TTTTCGTGCATTGTGTACAGGAGAAAAGGGCACTGGACCGACAACTGGGAAACCTCTGCATTTTAAAGGA
TGCCCTTTCCACCGAATTATTAAGAAATTTATGATTCAGGGTGGAGACTTCTCAAATCAGAATGGGACAG
GTGGAGAAAGTATTTATGGTGAAAAATTTGAAGATGAGAATTTTCATTATAAGCATGATCGGGAGGGTTT
GCTGAGCATGGCAAATGCAGGCCCCAATACAAATGGTTCTCAGTTCTTTATCACAACAGTTCCAACTCCT
CATTTGGATGGGAAACATGTGGTATTTGGTCAAGTAATAAAAGGACTAGGTGTGGCAAGGATGCTTGAAA
ATGTAGAAGTGAATGGTGAAAAACCTGCCAAACTCTGTGTTATTGCAGAATGTGGAGAATTGAAGGAAGG
GGATGAATGGGGAATATTCCCCAAAGATGGCTCTGGGGATAGTCATCCAGATTTCCCTGAGGATGCAGAC
ATAGACTTAAAGGATGTAGATAAAATTTTATTAATATCTGAAGACTTAAAAAACATTGGAAATACTTTTT
TCAAGTCTCAAAACTGGGAGATGGCTATTAAAAAATATGCAAAGGTTTTAAGGTACTTGGATAGTTCAAA
GGCTGTTATTGAGAAAGCAGATGTATCCAGACTGCAACCCATAGCCTTAAGTTGTGTGCTGAATATTGGT
GCTTGTAAATTGAAGATGTCAAATTGGCAGGGGGCAATTGACAGTTGCTTGGAGGCTCTTGAAATGGACC
CTTCAAACACTAAAGCACTATACCGAAAAGCACAAGGATGGCAAGGATTGAAAGAATATGATCAAGCATT
GGCTGATCTTAAGAAGGCGCAGGAGATAGCCCCAGGAGATAAAGCTATCCAGGCAGAATTGCTTAAAGTC
AAACAAATGATAAAGGCACAGAAAGATAAAGAGAAGGCAGTGTATGCAAAAATGTTTGCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001004279
Insert Size 1113 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001004279.1, NP_001004279.1
RefSeq Size 1353 bp
RefSeq ORF 1113 bp
Locus ID 361967
Cytogenetics 2q33
Gene Summary PPIases accelerate the folding of proteins. It catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides. Proposed to act as a co-chaperone in HSP90 complexes such as in unligated steroid receptors heterocomplexes. Different co-chaperones seem to compete for association with HSP90 thus establishing distinct HSP90-co-chaperone-receptor complexes with the potential to exert tissue-specific receptor activity control. May have a preference for estrogen receptor complexes and is not found in glucocorticoid receptor complexes. May be involved in cytoplasmic dynein-dependent movement of the receptor from the cytoplasm to the nucleus. May regulate MYB by inhibiting its DNA-binding activity. Involved in regulation of AHR signaling by promoting the formation of the AHR:ARNT dimer; the function is independent of HSP90 but requires the chaperone activity region. Involved in regulation of UV radiation-induced apoptosis. [UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.