Lsm6 (NM_001126085) Rat Untagged Clone

CAT#: RN214238

Lsm6 (untagged ORF) - Rat LSM6 homolog, U6 small nuclear RNA associated (S. cerevisiae) (Lsm6), (10 ug)


  "NM_001126085" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Lsm6"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Lsm6
Synonyms RGD1561937
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN214238 representing NM_001126085
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTCTGCGGAAGCAAACCCCTAGTGACTTCTTAAAGCAGATCATCGGGCGCCCAGTTGTGGTGAAAT
TAAACTCTGGCGTGGATTACCGAGGGGTCCTGGCCTGCCTGGATGGCTACATGAATATAGCATTGGAACA
GACAGAGGAGTATGTAAACGGACAGCTGAAGAATAAGTATGGAGACGCATTCATCCGCGGAAACAATGTG
CTGTACATAAGTACACAGAAGAGGCGGATGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001126085
ORF Size 243 bp
Insert Size 243
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001126085.1, NP_001119557.1
RefSeq Size 2119
RefSeq ORF 243
Locus ID 498934

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.