Smim11 (NM_001131000) Rat Untagged Clone

CAT#: RN214773

Smim11 (untagged ORF) - Rat hypothetical LOC100174909 (LOC100174909), (10 ug)


  "NM_001131000" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Smim11"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Smim11
Synonyms Fam165b; Smim11
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN214773 representing NM_001131000
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACTGGAAGGTTCTCGAACACGTGCCTCTGCTGCTGTATATCTTGGCAGCAAAGACCCTGATCCTTT
GCCTGGCCTTTGCGGGAGTGAAAATGTACCAGAGGAGAAGCTTGGAAGGAAAACTGCAAGCTGAGAAGAA
GCGGCAATCAGAGAGGAAAGAGAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001131000
ORF Size 168 bp
Insert Size 168
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001131000.1, NP_001124472.1
RefSeq Size 499
RefSeq ORF 168
Locus ID 100174909

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.