Wfdc18 (NM_133537) Rat Untagged Clone

CAT#: RN214848

Wfdc18 (untagged ORF) - Rat extracellular proteinase inhibitor (Expi), (10 ug)


  "NM_133537" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Wfdc18"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Wfdc18
Synonyms Expi; Kal1; WDNM1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN214848 representing NM_133537
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGACAGCCTCAGTCTTGCTTCTGGTGGCTTTGATCGCCGTGGGAATGAACATTACCTATGCTCTGT
TTTCTCCCACAAAATTAGAAAAACCTGGAAAGTGTCCCAAGAATCCCCCAAGAAGTATTGGCACTTGTGT
TGAATTATGCTCAGGAGATCAATCGTGCCCCAACATACAGAAGTGCTGTTCCAATGGCTGTGGTCATGTT
TGCAAATCTCCTGTCTTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_133537
ORF Size 231 bp
Insert Size 231
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_133537.2, NP_598221.2
RefSeq Size 440
RefSeq ORF 231
Locus ID 171059
Gene Summary may mediate the invasive and metastatic potential of mammary adenocarcinomas [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.