Ucn2 (NM_133385) Rat Untagged Clone

CAT#: RN214889

Ucn2 (untagged ORF) - Rat urocortin 2 (Ucn2), (10 ug)


  "NM_133385" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Ucn2"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Ucn2
Synonyms Ucn3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN214889 representing NM_133385
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGACCAGGTGGGCACTGGTGGTGTTTATGGTCCTGATGTTGGATAGGGTCCCAGGAACCCCTATCC
CCACCTTCCAGCTCCTCCCTCAGAACTATCCGGAGACAACTCCCAGCTCTGTGTCCTCAGAGAGCCCCTC
AGATACCACCACTGGGCCCTCAGCTTCCTGGAGCAACTCTAAAGCCAGCCCTTACCTGGACACCCGTGTC
ATACTCTCCCTGGATGTCCCCATTGGCCTCCTGCGGATCTTACTGGAACAGGCTCGGAACAAGGCTGCCA
GGAATCAGGCTGCTACTAATGCCCAAATACTAGCCCGTGTTGGCCGCCGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_133385
ORF Size 333 bp
Insert Size 333
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_133385.2, NP_596876.2
RefSeq Size 911
RefSeq ORF 333
Locus ID 170896
Gene Summary member of the corticotropin-releasing hormone (CRH)-related peptides; may play a role in cardiac hypertrophy and fibrosis; promotes cell proliferation of cardiac non-myocytes [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.