Npy (NM_012614) Rat Untagged Clone

CAT#: RN214992

Npy (untagged ORF) - Rat neuropeptide Y (Npy), (10 ug)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Npy
• Synonyms: NPY02; RATNPY; RATNPY02
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN214992 representing NM_012614
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATGCTAGGTAACAAACGAATGGGGCTGTGTGGACTGACCCTCGCTCTATCCCTGCTCGTGTGTTTGG
  GCATTCTGGCTGAGGGGTACCCCTCCAAGCCGGACAATCCGGGCGAGGACGCGCCAGCAGAGGACATGGC
  CAGATACTACTCCGCTCTGCGACACTACATCAATCTCATCACCAGACAGAGATATGGCAAGAGATCCAGC
  CCTGAGACACTGATTTCAGATCTCTTAATGAGAGAAAGCACAGAAAATGCCCCCAGAACAAGGCTTGAAG
  ACCCTTCCATGTGGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_012614
• ORF Size: 297 bp
• Insert Size: 297
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_012614.2, NP_036746.1
• RefSeq Size: 567
• RefSeq ORF: 297
• Locus ID: 24604
• Gene Summary: This gene encodes a neuropeptide that is widely expressed in the central nervous system and influences many physiological processes, including cortical excitability, stress response, food intake, circadian rhythms, and cardiovascular function. Studies in the rat model of depression (Flinders Sensitive Line) show that this gene is downregulated in the hippocampus and the prefrontal cortex compared to the control ((Flinders Resistant Line). Alternatively spliced transcript variants of this gene have been described, but the function of all the variants is not known. [provided by RefSeq, Jul 2012]