Rps29 (NM_012876) Rat Untagged Clone

CAT#: RN215537

Rps29 (untagged ORF) - Rat ribosomal protein S29 (Rps29), (10 ug)


  "NM_012876" in other vectors (3)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Rps29"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Rps29
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215537 representing NM_012876
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGTCACCAGCAGCTCTACTGGAGTCACCCGCGGAAGTTCGGCCAGGGTTCTCGCTCTTGCCGCGTCT
GCTCTAACCGCCACGGTCTGATCCGTAAATACGGGCTGAACATGTGCCGACAGTGCTTCCGTCAGTACGC
GAAGGACATAGGCTTCATTAAGTTGGACTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_012876
ORF Size 171 bp
Insert Size 171
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_012876.1, NP_037008.1
RefSeq Size 318
RefSeq ORF 171
Locus ID 25348
Gene Summary component of the 40S ribosome [RGD, Feb 2006]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.