Ost4 (NM_001134691) Rat Untagged Clone

CAT#: RN215703

Ost4 (untagged) - Rat oligosaccharyltransferase 4 homolog (S. cerevisiae) (Ost4), transcript variant 1

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Ost4
• Synonyms: Ost4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN215703 representing NM_001134691
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGATCACGGACGTGCAGCTCGCCATCTTCGCCAACATGCTGGGCGTGTCGCTTTTCTTGCTTGTGGTCC
  TCTATCACTACGTGGCAGTAAATAACCCCAAGAAGCAGGAATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001134691
• ORF Size: 114 bp
• Insert Size: 114
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001134691.1, NP_001128163.1
• RefSeq Size: 470
• RefSeq ORF: 114
• Locus ID: 100188932