Gng2 (NM_001257349) Rat Untagged Clone

CAT#: RN215724

Gng2 (untagged) - Rat guanine nucleotide binding protein (G protein), gamma 2 (Gng2), transcript variant 2


  "NM_001257349" in other vectors (1)

Reconstitution Protocol

USD 210.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Gng2"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Gng2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215724 representing NM_001257349
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCAGCAACAACACCGCCAGCATAGCGCAAGCCAGGAAACTGGTCGAGCAGCTGAAGATGGAAGCCA
GCATCGACAGGATAAAGGTGTCCAAGGCAGCTGCAGACTTGATGGCCTACTGTGAGGCACATGCCAAGGA
AGATCCCCTGCTGACCCCAGTCCCGGCCTCAGAAAATCCCTTTCGGGAGAAGAAGTTCTTCTGCGCCATC
CTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001257349
ORF Size 216 bp
Insert Size 216
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001257349.1, NP_001244278.1
RefSeq Size 3664
RefSeq ORF 216
Locus ID 80850
Gene Summary gamma 2 subunit of heterotrimeric G-proteins, which exchange GDP for GTP and activate downstream effectors [RGD, Feb 2006]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.