Gng2 (NM_031754) Rat Untagged Clone

CAT#: RN215725

Gng2 (untagged) - Rat guanine nucleotide binding protein (G protein), gamma 2 (Gng2), transcript variant 1

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Gng2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN215725 representing NM_031754
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCCAGCAACAACACCGCCAGCATAGCGCAAGCCAGGAAACTGGTCGAGCAGCTGAAGATGGAAGCCA
  GCATCGACAGGATAAAGGTGTCCAAGGCAGCTGCAGACTTGATGGCCTACTGTGAGGCACATGCCAAGGA
  AGATCCCCTGCTGACCCCAGTCCCGGCCTCAGAAAATCCCTTTCGGGAGAAGAAGTTCTTCTGCGCCATC
  CTTTAA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_031754
• ORF Size: 216 bp
• Insert Size: 216
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_031754.1, NP_113942.1
• RefSeq Size: 3681
• RefSeq ORF: 216
• Locus ID: 80850
• Gene Summary: gamma 2 subunit of heterotrimeric G-proteins, which exchange GDP for GTP and activate downstream effectors [RGD, Feb 2006]
  Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.