Enho (NM_001282336) Rat Untagged Clone

CAT#: RN215744

LOC100912292 (untagged) - Rat adropin-like (LOC100912292)


  "NM_001282336" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Enho"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Enho
Synonyms RGD1565232
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215744 representing NM_001282336
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGGCAGCCATCTCCCAGGGGGCTCTCATTGCCATAGTCTGCAATGGCCTGGTAGGCTTCCTGCTGC
TGCTGCTCTGGGTCATTCTCTGCTGGGCCTGCCACTCTCGCTCTGCTGACGTCGACTCTCTCTCAGAATC
CAGTCCCAACTCCAGCCCTGGCCCCTGTCCTGAGAAGGCGCCGCCGCCCCAGAAGCCAAGCCATGAAGGC
AGCTACCTGCTGCAGCCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001282336
ORF Size 231 bp
Insert Size 231
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001282336.1, NP_001269265.1
RefSeq Size 952
RefSeq ORF 231
Locus ID 100912292

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.