Apoc1 (NM_012824) Rat Untagged Clone

CAT#: RN215771

Apoc1 (untagged) - Rat apolipoprotein C-I (Apoc1), transcript variant 1


  "NM_012824" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Apoc1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Apoc1
Synonyms ALPCI; Apo-CIB; ApoC-IB; LRRG04
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215771 representing NM_012824
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGCTCTTCATCGCACTTCCTGTCCTGATCGTGGTCGTAGCCATGGCTTTGGAAGGCCCAGCCCCTG
CCCAGGCGGCCCCTGACTTTTCCAGCGCAATGGAGAGCTTACCGGATAAACTAAAAGAGTTTGGGAACAC
TTTGGAAGATAAGGCCCGGGCAGCCATTGAGCATATCAAACAGAAGGAAATTATGATCAAGACTCGGAAC
TGGTTTTCAGAGACGCTCAACAAAATGAAGGAGAAATTAAAAACCACATTTGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_012824
ORF Size 267 bp
Insert Size 267
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_012824.2, NP_036956.1
RefSeq Size 466
RefSeq ORF 267
Locus ID 25292
Gene Summary may play a role in lipid transport [RGD, Feb 2006]
Transcript Variant: This variant (1) represents the longer transcript. Transcript variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.