Atp5j2 (NM_001271117) Rat Untagged Clone

CAT#: RN215772

Atp5j2 (untagged) - Rat ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2 (Atp5j2)

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Atp5j2
• Synonyms: Atp5j2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN215772 representing NM_001271117
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGCGTCTATCGTGCCATTGAAGGAGAAGAAGCTCATGGAGGTTAAACTTAGAGAGCTGCCAAGCTGGA
  TATTGATGCGGGATTTCACCCCCAGTGGTATTGCAGGAGCCTTTCGGAGAGGCTATGACCGGTATTACAA
  CAAGTACATCAACGTTCGGAAAGGCAGCATCTCAGGGATTAACATGGTGCTGGCAGCCTACGTGGTTTTC
  AGCTACTGCATTTCTTACAAGGAACTCAAACACGAACGGCGACGCAAGTACCACTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001271117
• ORF Size: 267 bp
• Insert Size: 267
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001271117.1, NP_001258046.1
• RefSeq Size: 432
• RefSeq ORF: 267
• Locus ID: 690441
• Gene Summary: Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. Part of the complex F(0) domain. Minor subunit located with subunit a in the membrane. [UniProtKB/Swiss-Prot Function]