Swi5 (NM_001246661) Rat Untagged Clone

CAT#: RN215777

Swi5 (untagged) - Rat SWI5 recombination repair homolog (yeast) (Swi5)


  "NM_001246661" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Swi5"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Swi5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215777 representing NM_001246661
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATTGATGAGGGTGAGGAAGTCACCGAGGAGACCTTGAATTCTGACATTCAGAAACTGAAGGAGAAGC
AGGACATGCTGGACAAGGAGATCTCCCAGTTAATAGCCGAGGGCTATCGTGTGATTGAGCTGGAGCAGCA
CATCTCCCTCCTCCATGAGTACAATGACATCAAGGATGTGTCGCAGATGCTGCTGGGCAAACTGGCTGTG
ACTCGAGGTGTTACCACCAAGGAGTTATATCCGGATTTTGATCTAAACCCAAATGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001246661
ORF Size 270 bp
Insert Size 270
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001246661.1, NP_001233590.1
RefSeq Size 710
RefSeq ORF 270
Locus ID 499779

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.