Nps (NM_001271113) Rat Untagged Clone

CAT#: RN215779

Nps (untagged) - Rat neuropeptide S (Nps)


  "NM_001271113" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Nps
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215779 representing NM_001271113
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATTGGCTCATTAAAACTCAACCTCATCTTAGCTCTGTCGCTGTCCGTGGTACACGTGATTTGGAGTT
ATCCGGTCCTCTCTTCCAAGGTGCCTGGGAAGCCTGATTACTTTCTCATTTTGCTGAGTACCTGCCCAGC
CAGGCTGGAGGGGAGCGACGGGCTAGCTTTTCTAAAGCCAATTTTGGAGAAGACGTCGATGAAAAGGTCC
TTTCGCAACGGAGTCGGCTCAGGGGTGAAAAAAACTTCATTTCGAAGAGCAAAGCAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271113
ORF Size 270 bp
Insert Size 270
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001271113.1, NP_001258042.1
RefSeq Size 270
RefSeq ORF 270
Locus ID 100360071

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.