Hcfc1r1 (NM_001100492) Rat Untagged Clone

CAT#: RN215842

Hcfc1r1 (untagged) - Rat host cell factor C1 regulator 1 (XPO1-dependent) (Hcfc1r1), transcript variant 2


  "NM_001100492" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Hcfc1r1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Hcfc1r1
Synonyms Hpip
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215842 representing NM_001100492
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATCCTGCAACAGCCCCTGGAGCGAGGCCCCCCAGGGCGGGACCCACGGGCCACCACTGGGGTGACTC
TTGGCCTGGATACCAGGGAACCCTTGCACAAGCACTTCCTGTCTGAGGAGAACATGGCCACCCATTTCTC
CCGACTCAGCCTACATAATGACCACCCCTATTGCAGTCCCCCTGTGACTTTTCCCGAAGCCCTGCCACCA
CTCAGGAGCCCTTGCCCCGAGCTGCTTCTCTGGCGCTATCCCGGGAGCCTGATTCCTGAGGCCCTCCGGC
TGCTGAGGCTGGGGGATAACCCCAGTCCCTACTACTCTGCGTCCCCAGCTGGGGAGATCATGGAGCTCTG
A


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001100492
ORF Size 351 bp
Insert Size 351
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001100492.1, NP_001093962.1
RefSeq Size 629
RefSeq ORF 351
Locus ID 287097
Gene Summary may inhibit herpes simplex virus type 1 IE3 promoter activity [RGD, Feb 2006]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.