Pfdn6 (NM_001164718) Rat Untagged Clone

CAT#: RN215863

Pfdn6 (untagged) - Rat prefoldin subunit 6 (Pfdn6)


  "NM_001164718" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Pfdn6"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Pfdn6
Synonyms Ke2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215863 representing NM_001164718
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCGAACTGATCCAAAAGAAGCTGCAGGGAGAGGTAGAGAAATATCAACAGCTGCAGAAGGACTTGA
GTAAATCCATGTCAGGGAGGCAGAAGCTTGAAGCCCAGCTAACGGAAAATAACATTGTGAAGGAGGAACT
GGCCTTGCTGGATGGATCCAACGTGGTCTTTAAGCTTCTGGGACCCGTGCTTGTCAAACAGGAGCTGGGG
GAGGCTCGGGCCACAGTGGGGAAGAGGCTAGACTACATCACAGCGGAAATTAAGCGCTACGAATCGCAGC
TTCGGGACCTCGAAAGGCAGTCAGAGCAACAGAGGGAAACCCTTGCTCAGTTGCAGCAGGAGTTCCAGCG
GGCCCAGAACGCAAAGGCTCCCGGGAAAGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001164718
ORF Size 384 bp
Insert Size 384
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001164718.1, NP_001158190.1
RefSeq Size 588
RefSeq ORF 384
Locus ID 309629
Gene Summary possible chaperone protein; mouse homolog is expressed in the nucleus and is involved in protein folding [RGD, Feb 2006]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.