Obp3 (NM_147215) Rat Untagged Clone

CAT#: RN215967

Obp3 (untagged) - Rat alpha-2u globulin PGCL4 (Obp3), transcript variant 1


  "NM_147215" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Obp3"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Obp3
Synonyms MGC108576
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215967 representing NM_147215
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGCTGTTGCTGCTGCTGCTGTGTCTGGGCCTGACCCTGGTCTGTGGCCATGCAGAAGAAGCTAGTT
TCGAGAGAGGGAACCTCGATGTGGACAAGCTCAATGGGGATTGGTTTTCTATTGTCGTGGCCTCTGATAA
AAGAGAAAAGATAGAAGAGAACGGCAGCATGAGAGTTTTTGTGCAGCATATCGATGTCTTGGAGAATTCC
TTAGGCTTCACGTTCCGTATTAAGGAAAATGGAGTGTGCACAGAATTTTCTTTGGTTGCCGACAAAACAG
CAAAGGATGGCGAATATTTTGTTGAGTATGACGGAGAGAATACATTTACTATACTTAAGACAGACTATGA
CAATTATGTCATGTTTCATCTCGTTAATGTCAACAACGGGGAAACCTTCCAGCTGATGGAGCTCTATGGC
AGAACAAAGGATCTGAGTTCAGACATCAAGGAAAAGTTTGCAAAACTATGTGTGGCACATGGAATCACTA
GGGACAATATCATTGACCTAACCAAGACTGATCGCTGTCTCCAGGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_147215
ORF Size 540 bp
Insert Size 540
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_147215.2, NP_671748.2
RefSeq Size 1006
RefSeq ORF 540
Locus ID 259247
Gene Summary odorant binding protein and member of the alpha(2u)-globulin family [RGD, Feb 2006]
Transcript Variant: The variant (1) represents the longest transcript. Variant 1, 2, and 3 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.