Scn1b (NM_001271046) Rat Untagged Clone

CAT#: RN215977

Scn1b (untagged) - Rat sodium channel, voltage-gated, type I, beta subunit (Scn1b), transcript variant 3


  "NM_001271046" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Scn1b"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Scn1b
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215977 representing NM_001271046
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCTTCAAAATCCTGTGTATCTCCTGTAAGCGTCGTAGTGAGACCACCGCCGAGACCTTCACGGAGT
GGACCTTCCGCCAGAAGGGCACAGAGGAATTTGTCAAGATCCTACGCTATGAGAATGAGGTGCTGCAGCT
GGAGGAAGATGAGCGCTTTGAGGGCCGTGTGGTGTGGAACGGTAGTCGGGGCACCAAGGACCTGCAGGAC
CTGTCCATCTTCATCACCAATGTCACCTACAACCACTCTGGCGACTACGAATGTCACGTCTACCGTCTCC
TCTTCTTTGATAATTACGAGCACAACACCAGCGTCGTCAAGAAGATCCACCTGGAGGTGGTGGACAAGGC
CAACAGAGATATGGCATCCATCGTGTCAGAGATCATGATGTACGTGCTCATTGTGGTGTTAACCATATGG
CTCGTGGCGGAGATGGTGTACTGCTACAAGAAGATTGCTGCTGCCACGGAAGCTGCTGCACAAGAGAATG
CCTCGGAATACCTGGCCATTACTTCCGAGAGCAAAGAGAACTGTACAGGCGTCCAGGTGGCTGAATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001271046
ORF Size 558 bp
Insert Size 558
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001271046.2, NP_001257975.1
RefSeq Size 1281
RefSeq ORF 558
Locus ID 29686
Gene Summary has voltage sensitive sodium channel activity when coexpressed with alpha subunits; plays a role in initiation and propogation of the action potential [RGD, Feb 2006]
Transcript Variant: This variant (3) contains an alternate exon in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.