Agxt (NM_001270659) Rat Untagged Clone

CAT#: RN215983

Agxt (untagged) - Rat alanine-glyoxylate aminotransferase (Agxt), transcript variant 2


  "NM_001270659" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Agxt"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Agxt
Synonyms AGT; Spat; SPT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215983 representing NM_001270659
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCCCACCAGGGATCTCCCTCATCTCCTTCAACGACAAGGCCAAATCCAAAGTCTACTCCCGGAAGAC
AAAGCCAGTCTCCTTCTACACAGACATCACTTATTTGTCCAAGTTGTGGGGCTGTGAGGGCAAGACCAGA
GTGTTCTTTTCTATTCCCCAGAATTCATCATACGTTGCCTGTCATCAGCTTATACTGCCTGAGGGAGAGC
CTAGCACTCATTTCAGAGCAGGGCCTGGAGAATTCCTGGCGGCGTCACAGGGAGGCTACAGCACATCTGC
ACAAGTGCCTGCGGGAGTTGGGCTTAAAGTTCTTTGTGAAGGACCCGGAAATCCGGCTACCTACAATCAC
CACCGTGACCGTGCCTGCCGGCTACAACTGGAGGGACATCGTCAGCTACGTGCTGGACCACTTCAACATT
GAAATCTCTGGTGGTCTTGGGCCCTCTGAGGATAAGGTGCTGCGGATTGGCCTCCTGGGCTACAACGCCA
CCACAGAGAATGCGGACCGTGTAGCGGAGGCCCTGAGGGAGGCCCTGCAACATTGTCCTAAGAATAAATT
GTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001270659
ORF Size 564 bp
Insert Size 564
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001270659.1, NP_001257588.1
RefSeq Size 957
RefSeq ORF 564
Locus ID 24792
Gene Summary This gene encodes alanine-glyoxylate aminotransferase, which catalyzes the interconversion of L-alanine and glyoxylate to pyruvate and glycine. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. The longer transcript variant includes an upstream translation start codon and a downstream translation start codon. The upstream start codon initiates the translation of the mitochondrial enzyme precursor while the downstream start codon initiates the translation of the peroxisomal enzyme (see PMID:2332438). [provided by RefSeq, Feb 2013]
Transcript Variant: This variant (2) has multiple differences, compared to variant 1. The resulting isoform (2) is much shorter and has a distinct N-terminus, compared to isoform 1. The cellular location of isoform 2 is not determined.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.