Park7 (NM_001277250) Rat Untagged Clone

CAT#: RN215989

Park7 (untagged) - Rat parkinson protein 7 (Park7), transcript variant 2


  "NM_001277250" in other vectors (1)

Reconstitution Protocol

USD 210.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Park7"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Park7
Synonyms CAP1; DJ-1; Dj1; SP22
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215989 representing NM_001277250
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCATCCAAAAGAGCTCTGGTCATCCTAGCCAAAGGAGCAGAGGAGATGGAGACAGTGATTCCTGTGG
ACATCATGCGGCGAGCTGGGATTAAAGTCACCGTTGCAGGCTTGGCTGGGAAGGACCCCGTGCAGTGTAG
CCGTGATGTAGTGATTTGTCCGGATACCAGTCTGGAAGAAGCAAAAACACAGGGACCATACGATGTGGTT
GTTCTTCCAGGAGGAAATCTGGGTGCACAGAACTTATCTGAGTCGGCTTTGGTGAAGGAGATCCTCAAGG
AGCAGGAGAACAGGAAGGGCCTCATAGCTGCCATCTGTGCGGGTCCTACGGCCCTGCTGGCTCACGAAGT
AGGCTTTGGATGCAAGGTTACATCGCACCCATTGGCTAAGGACAAAATGATGAACGGCAGTCACTACAGC
TACTCAGAGAGCCGTGTGGAGAAGGACGGCCTCATCCTCACCAGCCGTGGGCCTGGGACCAGCTTCGAGT
TTGCGCTGGCCATTGTGGAGGCACTCAGTGGCAAGGACATGGCTAACCAAGTGAAGGCCCCGCTTGTTCT
CAAAGACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001277250
ORF Size 570 bp
Insert Size 570
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001277250.1, NP_001264179.1
RefSeq Size 872
RefSeq ORF 570
Locus ID 117287
Gene Summary displays a specific localization pattern to the anterior-ventral surface of the equatorial segment; may play a role in sperm-egg interactions and fertilization [RGD, Feb 2006]
Transcript Variant: This variant (2) includes an alternate penultimate exon, compared to variant 1, resulting in a novel 3' coding region and 3' UTR. The encoded isoform (2) is shorter, compared to isoform 1. Variants 2, 3, 4, 5, and 6 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.