Snap25 (NM_001270575) Rat Untagged Clone

CAT#: RN216042

Snap25 (untagged) - Rat synaptosomal-associated protein 25 (Snap25), transcript variant 1


  "NM_001270575" in other vectors (1)

Reconstitution Protocol

USD 220.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Snap25"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Snap25
Synonyms SNAP-25a; SNAP-25B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN216042 representing NM_001270575
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCGAGGACGCAGACATGCGTAATGAACTGGAGGAGATGCAGAGGAGGGCTGACCAGCTGGCTGATG
AGTCCCTGGAAAGCACCCGTCGCATGCTGCAGCTGGTCGAAGAGAGTAAAGATGCTGGCATCAGGACTTT
GGTTATGTTGGATGAGCAAGGCGAACAACTCGATCGTGTCGAAGAAGGCATGAACCATATCAACCAAGAC
ATGAAGGAGGCCGAGAAAAATTTAAAAGATTTAGGCAAATGCTGTGGCCTTTTCATATGTCCTTGTAACA
AGCTTAAATCCAGTGATGCTTACAAAAAAGCCTGGGGCAATAATCAGGATGGAGTAGTGGCCAGCCAGCC
TGCCCGTGTGGTGGATGAACGGGAGCAGATGGCCATCAGTGGTGGCTTCATCCGCAGGGTAACAAACGAT
GCCCGGGAAAATGAAATGGATGAAAACCTAGAGCAGGTGAGCGGCATCATCGGAAACCTCCGTCATATGG
CCCTAGACATGGGCAATGAGATTGACACCCAGAATCGCCAGATTGACAGGATCATGGAGAAGGCTGACTC
CAACAAAACCAGAATTGATGAAGCCAACCAACGTGCAACAAAGATGCTGGGAAGTGGTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001270575
ORF Size 621 bp
Insert Size 621
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001270575.1, NP_001257504.1
RefSeq Size 2135
RefSeq ORF 621
Locus ID 25012
Gene Summary Synaptic vesicle membrane docking and fusion is mediated by SNAREs (soluble N-ethylmaleimide-sensitive factor attachment protein receptors) located on the vesicle membrane (v-SNAREs) and the target membrane (t-SNAREs). The assembled v-SNARE/t-SNARE complex consists of a bundle of four helices, one of which is supplied by v-SNARE and the other three by t-SNARE. For t-SNAREs on the plasma membrane, the protein syntaxin supplies one helix and the protein encoded by this gene contributes the other two. Therefore, this gene product is a presynaptic plasma membrane protein. It is essential for regulated exocytosis in neuronal cells. Alternative transcript variants encoding two different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (1, also known as a) encodes isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.