Vegfa (NM_001287107) Rat Untagged Clone

CAT#: RN216058

Vegfa (untagged) - Rat vascular endothelial growth factor A (Vegfa), transcript variant 1

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Vegfa
• Synonyms: Vegf; VEGF-A; VEGF111; VEGF164; VPF
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN216058 representing NM_001287107
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGAACTTTCTGCTCTCTTGGGTGCACTGGACCCTGGCTTTACTGCTGTACCTCCACCATGCCAAGTGGT
  CCCAGGCTGCACCCACGACAGAAGGGGAGCAGAAAGCCCATGAAGTGGTGAAGTTCATGGACGTCTACCA
  GCGCAGCTATTGCCGTCCAATTGAGACCCTGGTGGACATCTTCCAGGAGTACCCCGATGAGATAGAGTAT
  ATCTTCAAGCCGTCCTGTGTGCCCCTAATGCGGTGTGCGGGCTGCTGCAATGATGAAGCCCTGGAGTGCG
  TGCCCACGTCGGAGAGCAACGTCACTATGCAGATCATGCGGATCAAACCTCACCAAAGCCAGCACATAGG
  AGAGATGAGCTTCCTGCAGCATAGCAGATGTGAATGCAGACCAAAGAAAGATAGAACAAAGCCAGAAAAA
  AAATCAGTTCGAGGAAAGGGAAAGGGTCAAAAACGAAAGCGCAAGAAATCCCGGTTTAAATCCTGGAGCG
  TTCACTGTGAGCCTTGTTCAGAGCGGAGAAAGCATTTGTTTGTCCAAGATCCGCAGACGTGTAAATGTTC
  CTGCAAAAACACAGACTCGCGTTGCAAGGCGAGGCAGCTTGAGTTAAACGAACGTACTTGCAGATGTGAC
  AAGCCAAGGCGGTGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001287107
• ORF Size: 645 bp
• Insert Size: 645
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001287107.1, NP_001274036.1
• RefSeq Size: 3546
• RefSeq ORF: 645
• Locus ID: 83785
• Gene Summary: This gene is a member of the PDGF/VEGF growth factor family. It encodes a heparin-binding protein, which exists as a disulfide-linked homodimer. This growth factor induces proliferation and migration of vascular endothelial cells, and is essential for both physiological and pathological angiogenesis. Disruption of this gene in mice resulted in abnormal embryonic blood vessel formation. This gene is upregulated in many known tumors and its expression is correlated with tumor stage and progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. There is also evidence for alternative translation initiation from upstream non-AUG (CUG) codons resulting in additional isoforms. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is antiangiogenic. Expression of some isoforms derived from the AUG start codon is regulated by a small upstream open reading frame, which is located within an internal ribosome entry site. [provided by RefSeq, Nov 2015]
  Transcript Variant: This variant (1) represents the longest transcript. This variant can initiate translation from non-AUG (CUG) site, and also from a downstream, in-frame AUG site. The isoform (6) represented in this RefSeq is derived from the AUG start codon and it is shorter at the N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.