Bag1 (NM_001256084) Rat Untagged Clone

CAT#: RN216075

Bag1 (untagged) - Rat BCL2-associated athanogene (Bag1), transcript variant 1


  "NM_001256084" in other vectors (1)

Reconstitution Protocol

USD 230.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Bag1"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Bag1
Synonyms Bag-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN216075 representing NM_001256084
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCCAGACCGAGGAGATGGTCCAGACGGAGGAAATGGAACCACCCACACTCAGCGTGGTCGTCACCC
ACAGCAATGAGAGGTATGACCTTCTTGTTACCCCACAGCAAGGTAACAGTGAGCCAATTGTCCAAGACCT
GGCTCAGCTTGTTGAAGAGGCCACAGGAGTTCCACTACCTTTTCAGAAGCTCATATTTAAGGGCAAATCT
CTGAAAGAAATGGAAACACCCTTGTCAGCACTTGGAATGCAAAATGGTTGCCGAGTCATGTTAATTGGTG
AAAAGAGCAATCCAGAAGAAGAGGCTGAGTTGAAAAAGCTGAAGGACTTGGAGGTATCTGTGGAGAAGAC
AGCTAACCACCTGGAAGAGTTGAATAAAGAGCTTTCTGACATCCAGCAGGGTTTTCTGGCTAAGGAATTA
CAAGCGGAGGCTCTCTGCAGACTTGATAGGAAAATAAAGGCCACAATTGAGCAATTCATGAAGATCTTGG
AGGAGATTGACACAATGGTCCTACCAGAAAACTTTAAAGACAGCAGGCTAAAAAGGAAGAATTTGGTGAA
AAAGGTTCAGGTGTTCCTAGCAGAGTGTGATACAGTGGAGCAGTACATCTGCCAAGAGACAGAGCGGCTG
CAGTCTACAAACTTGGCCCTGCCTGAATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001256084
ORF Size 660 bp
Insert Size 660
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001256084.1, NP_001243013.1
RefSeq Size 1308
RefSeq ORF 660
Locus ID 297994
Gene Summary The oncogene Bcl2 encodes a membrane protein that blocks a step in a pathway leading to apoptosis or programmed cell death. Studies in human and mouse suggest that the protein encoded by this gene (referred to as Bcl2-associated athanogene) binds to Bcl2 protein. It enhances the anti-apoptotic effects of Bcl2 and represents a link between growth factor receptors and anti-apoptotic mechanisms. At least two protein isoforms are encoded by this mRNA through the use of a non-AUG (CUG) start site and an alternative, downstream, AUG translation initiation site. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes multiple isoforms due to the use of alternative translation initiation codons. The longer isoform (BAG-1L or p50) is derived from an upstream non-AUG (CUG) start codon, while the shorter isoform (BAG-1S or p32) is derived from a downstream AUG start codon. The shorter isoform (1S) is represented in this RefSeq.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.