Cebpa (NM_001287579) Rat Untagged Clone

CAT#: RN216117

Cebpa (untagged) - Rat CCAAT/enhancer binding protein (C/EBP), alpha (Cebpa), transcript variant 1


  "NM_001287579" in other vectors (1)

Reconstitution Protocol

USD 250.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Cebpa"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Cebpa
Synonyms DBPCEP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN216117 representing NM_001287579
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCGCGGGGGCGCACGGACCCCCTCCCGGCTACGGCTGTGCGGCGGCCGGCTACCTGGACGGCAGGC
TGGAGCCCCTGTACGAGCGCGTCGGGGCGCCCGCGCTGCGGCCGCTGGTGATCAAGCAGGAGCCCCGCGA
GGAGGACGAGGCGAAGCAGCTGGCGCTGGCCGGCCTCTTCCCCTATCAGCCCCCGCCGCCGCCGCCGCCA
CCGCACCCGCACGCGTCTCCCGCGCACTTGGCCGCCCCTCACTTGCAGTTCCAGATCGCACACTGCGGCC
AGACCACCATGCACCTGCAGCCTGGCCACCCTACGCCGCCGCCGACGCCCGTGCCCAGCCCTCATCCCGC
GCCTGCAATGGGTGCTGCGGGCCTGCCGGGCCCCGGGGGCTCGCTCAAGGGCTTGGCTGGTCCGCACCCC
GACCTCCGCACCGGCGGCGGCGGCGGCGGCGGGGCCGGCGCGGGCAAGGCCAAGAAGTCGGTGGATAAGA
ACAGCAACGAGTACCGGGTACGGCGGGAACGCAACAACATCGCGGTGCGCAAGAGCCGAGATAAAGCCAA
ACAGCGCAACGTGGAGACGCAGCAGAAGGTGTTGGAGTTGACCAGTGACAATGACCGCCTGCGCAAGCGG
GTGGAACAGCTGAGCCGTGAACTGGACACGCTGCGGGGTATCTTCCGCCAGCTGCCTGAGAGCTCCTTGG
TCAAGGCCATGGGCAACTGCGCGTGA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001287579
ORF Size 726 bp
Insert Size 726
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001287579.1, NP_001274508.1
RefSeq Size 2673
RefSeq ORF 726
Locus ID 24252
Gene Summary This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain and recognizes the CCAAT motif in the promoters of target genes. The encoded protein functions in homodimers and also heterodimers with CCAAT/enhancer-binding proteins beta and gamma. Activity of this protein can modulate the expression of genes involved in cell cycle regulation as well as in body weight homeostasis. The use of alternative in-frame non-AUG (CUG) and AUG start codons results in protein isoforms with different lengths. Differential translation initiation is mediated by an out-of-frame, upstream open reading frame which is located between the CUG and the first AUG start codons. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (1) can initiate translation from an upstream non-AUG (CUG) site, and also from three conserved downstream, in-frame AUG sites. The isoform (b) represented in this RefSeq results from translation initiation at the third AUG start codon. Isoform b has a shorter N-terminus, compared to isoform c. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.