Aqp4 (NM_001270559) Rat Untagged Clone

CAT#: RN216132

Aqp4 (untagged) - Rat aquaporin 4 (Aqp4), transcript variant 4

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Aqp4
• Synonyms: AQP-4; Miwc; WCH4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN216132 representing NM_001270559
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGTGGCTTTCAAAGGCGTCTGGACTCAAGCCTTCTGGAAGGCGGTCACAGCAGAGTTCCTGGCCATGC
  TCATCTTTGTTCTGCTCAGCGTGGGATCCACCATTAACTGGGGTGGCTCAGAGAACCCCCTACCTGTGGA
  CATGGTCCTCATCTCCCTCTGCTTTGGACTCAGCATTGCCACCATGGTTCAGTGCTTCGGCCACATCAGC
  GGTGGCCACATCAACCCAGCGGTGACAGTGGCCATGGTGTGCACACGAAAGATCAGCATCGCCAAGTCCG
  TCTTCTACATCACTGCGCAGTGCCTGGGGGCCATCATCGGAGCTGGGATCCTCTACCTGGTCACACCCCC
  CAGCGTGGTGGGAGGATTGGGAGTCACCACGATCAATTATACCGGAGCCAGCATGAATCCAGCTCGATCC
  TTTGGCCCTGCAGTTATCATGGGAAACTGGGAAAACCACTGGATATATTGGGTTGGACCAATCATAGGCG
  CTGTGCTGGCAGGTGCACTTTACGAGTATGTCTTCTGTCCTGACGTGGAGCTCAAACGTCGCCTAAAGGA
  AGCCTTCAGCAAAGCTGCACAGCAGACGAAAGGGAGCTACATGGAGGTGGAGGACAACCGGAGCCAAGTG
  GAGACAGAAGACTTGATCCTGAAGCCCGGGGTGGTGCATGTGATCGACATTGACCGTGGAGACGAGAAGA
  AGGGGAAGGACTCGTCTGGAGAGGTATTATCTTCTGTATGA
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270559
• ORF Size: 741 bp
• Insert Size: 741
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001270559.2, NP_001257488.1
• RefSeq Size: 4853
• RefSeq ORF: 741
• Locus ID: 25293
• Gene Summary: This gene encodes a member of the aquaporin family of intrinsic membrane proteins that function as water-selective channels in the plasma membranes of many cells. This protein is the predominant aquaporin found in brain and has an important role in brain water homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2015]
  Transcript Variant: This variant (4, also known as AQP4d) contains an alternate 5' terminal exon and lacks an in-frame coding exon compared to variant 1. These changes result in translation initiation from an in-frame, downstream start codon, and an isoform (4) with a shorter N-terminus and missing an internal protein segment compared to isoform M1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.