Bdnf (NM_001270632) Rat Untagged Clone

CAT#: RN216146

Bdnf (untagged) - Rat brain-derived neurotrophic factor (Bdnf), transcript variant 4


  "NM_001270632" in other vectors (1)

Reconstitution Protocol

USD 270.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "Bdnf"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Bdnf
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN216146 representing NM_001270632
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCATCCTTTTCCTTACTATGGTTATTTCATACTTCGGTTGCATGAAGGCTGCGCCCATGAAAGAAG
CAAACGTCCACGGACAAGGCAACTTGGCCTACCCAGCTGTGCGGACCCATGGGACTCTGGAGAGCGTGAA
TGGGCCCAGGGCAGGTTCGAGAGGTCTGACGACGACGTCCCTGGCTGACACTTTTGAGCACGTGATCGAA
GAGCTGCTGGATGAGGACCAGAAGGTTCGGCCCAACGAAGAAAACCATAAGGACGCGGACTTGTACACTT
CCCGGGTGATGCTCAGCAGTCAAGTGCCTTTGGAGCCTCCTCTGCTCTTTCTGCTGGAGGAATACAAAAA
TTACCTGGATGCCGCAAACATGTCTATGAGGGTTCGGCGCCACTCCGACCCCGCCCGCCGTGGGGAGCTG
AGCGTGTGTGACAGTATTAGCGAGTGGGTCACAGCGGCAGATAAAAAGACTGCAGTGGACATGTCCGGTG
GGACGGTCACAGTCCTGGAGAAAGTCCCGGTATCAAAAGGCCAACTGAAGCAATATTTCTACGAGACCAA
GTGTAATCCCATGGGTTACACGAAGGAAGGCTGCAGGGGCATAGACAAAAGGCACTGGAACTCGCAATGC
CGAACTACCCAATCGTATGTTCGGGCCCTTACTATGGATAGCAAAAAGAGAATTGGCTGGCGGTTCATAA
GGATAGACACTTCCTGTGTATGTACACTGACCATTAAAAGGGGAAGATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001270632
ORF Size 750 bp
Insert Size 750
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001270632.1, NP_001257561.1
RefSeq Size 4086
RefSeq ORF 750
Locus ID 24225
Gene Summary plays a role in the development of hippocampal long term potentiation; involved in regulation of synaptic plasticity [RGD, Feb 2006]
Transcript Variant: This variant (4, also known as IIB) has an alternate 5' exon and uses a downstream start codon, compared to variant 1. The resulting isoform (3) has a shorter N-terminus, compared to isoform 1. Variants 3-10 encode the same isoform 3.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.