Aqp4 (NM_001270558) Rat Untagged Clone

CAT#: RN216200

Aqp4 (untagged) - Rat aquaporin 4 (Aqp4), transcript variant 3


  "NM_001270558" in other vectors (1)

Reconstitution Protocol

USD 280.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "Aqp4"

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Symbol Aqp4
Synonyms AQP-4; Miwc; WCH4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN216200 representing NM_001270558
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTGACGGAGCTGCAGCGAGGCGGTGGGGTAAGTGTGGACCTCCCTGCAGCAGAGAGAGCATCATGG
TGGCTTTCAAAGGCGTCTGGACTCAAGCCTTCTGGAAGGCGGTCACAGCAGAGTTCCTGGCCATGCTCAT
CTTTGTTCTGCTCAGCGTGGGATCCACCATTAACTGGGGTGGCTCAGAGAACCCCCTACCTGTGGACATG
GTCCTCATCTCCCTCTGCTTTGGACTCAGCATTGCCACCATGGTTCAGTGCTTCGGCCACATCAGCGGTG
GCCACATCAACCCAGCGGTGACAGTGGCCATGGTGTGCACACGAAAGATCAGCATCGCCAAGTCCGTCTT
CTACATCACTGCGCAGTGCCTGGGGGCCATCATCGGAGCTGGGATCCTCTACCTGGTCACACCCCCCAGC
GTGGTGGGAGGATTGGGAGTCACCACGATCAATTATACCGGAGCCAGCATGAATCCAGCTCGATCCTTTG
GCCCTGCAGTTATCATGGGAAACTGGGAAAACCACTGGATATATTGGGTTGGACCAATCATAGGCGCTGT
GCTGGCAGGTGCACTTTACGAGTATGTCTTCTGTCCTGACGTGGAGCTCAAACGTCGCCTAAAGGAAGCC
TTCAGCAAAGCTGCACAGCAGACGAAAGGGAGCTACATGGAGGTGGAGGACAACCGGAGCCAAGTGGAGA
CAGAAGACTTGATCCTGAAGCCCGGGGTGGTGCATGTGATCGACATTGACCGTGGAGACGAGAAGAAGGG
GAAGGACTCGTCTGGAGAGGTATTATCTTCTGTATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001270558
ORF Size 807 bp
Insert Size 807
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone expresses the complete ORF with c-terminal tags of Myc-DDK.
Reference Data
RefSeq NM_001270558.2, NP_001257487.1
RefSeq Size 4845
RefSeq ORF 807
Locus ID 25293
Gene Summary This gene encodes a member of the aquaporin family of intrinsic membrane proteins that function as water-selective channels in the plasma membranes of many cells. This protein is the predominant aquaporin found in brain and has an important role in brain water homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2015]
Transcript Variant: This variant (3, also known as AQP4b) lacks an in-frame coding exon compared to variant 1. The resulting isoform (3) is shorter, missing an internal protein segment compared to isoform M1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.