Cebpb (NM_001301715) Rat Untagged Clone

CAT#: RN216223

Cebpb (untagged) - Rat CCAAT/enhancer binding protein (C/EBP), beta (Cebpb), transcript variant 1

Specifications

Product Data

• Type: Rat Untagged Clone
• Tag: Tag Free
• Symbol: Cebpb
• Synonyms: Il6dbp; NF-IL6; TCF5
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >RN216223 representing NM_001301715
  Red=Cloning site Blue=ORF Orange=Stop codon
  
  TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  ATGGAAGTGGCCAACTTCTACTACGAGCCCGACTGCCTGGCCTACGGGGCCAAGGCGGCCCGCGCCGCGC
  CGCGCGCCCCCGCCGCCGAGCCGGCCATCGGCGAGCACGAGCGCGCCATCGACTTCAGCCCCTACCTGGA
  GCCGCTCGCGCCCGCCGCCGCGGACTTCGCCGCGCCCGCGCCCGCGCACCACGACTTCCTTTCCGACCTC
  TTCGCCGACGACTACGGCGCCAAGCCGAGCAAGAAGCCGTCCGACTACGGTTACGTGAGCCTCGGCCGCG
  CGGGCGCCAAGGCCGCACCGCCCGCCTGCTTCCCGCCGCCGCCTCCCGCCGCACTCAAGGCCGAGCCGGG
  CTTCGAACCCGCGGACTGCAAGCGCGCGGACGACGCGCCCGCCATGGCGGCCGGCTTCCCGTTCGCCCTG
  CGCGCCTACCTGGGCTACCAGGCGACGCCGAGCGGCAGCAGCGGCAGCCTGTCCACGTCGTCGTCGTCCA
  GCCCGCCCGGGACGCCGAGCCCCGCCGACGCCAAGGCCGCGCCCGCCGCCTGCTTCGCGGGGCCGCCGGC
  CGCGCCCGCCAAGGCCAAGGCCAAGAAGGCGGTGGACAAGCTGAGCGACGAGTACAAGATGCGGCGCGAG
  CGCAACAACATCGCGGTGCGCAAGAGCCGCGACAAGGCCAAGATGCGCAACCTGGAGACGCAGCACAAGG
  TGCTGGAGCTGACGGCGGAGAACGAGCGGCTGCAGAAGAAGGTGGAGCAGCTGTCGCGAGAGCTCAGCAC
  GCTGCGGAACTTGTTCAAGCAGCTGCCCGAGCCGCTGCTGGCCTCGGCGGGTCACTGCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Restriction Sites: SgfI-MluI
• ACCN: NM_001301715
• ORF Size: 831 bp
• Insert Size: 831
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This clone expresses the complete ORF with c-terminal tags of Myc-DDK.

Reference Data

• RefSeq: NM_001301715.1, NP_001288644.1
• RefSeq Size: 1475
• RefSeq ORF: 831
• Locus ID: 24253
• Gene Summary: This intronless gene encodes a member of the transcription factor family whose members contain a basic leucine-zipper domain. The encoded protein functions as a homodimer but can also form heterodimers with CCAAT/enhancer-binding proteins alpha, delta, and gamma. The encoded protein plays important roles in several cellular processes and in various diseases, including regulating cell proliferation, differentiation, apoptosis and neuroinflammation, and being involved in brain injury and inflammatory progression. The use of alternative in-frame AUG start codons results in multiple protein isoforms, each with different cellular localizations and distinct biological functions. [provided by RefSeq, Sep 2014]
  Transcript Variant: This variant (1) encodes multiple isoforms through the use of alternative translation initiation codons. The isoform [LAP2, also known as LAP (liver activating protein), p34 or CRP2 (c/EBP-related protein 2)] represented in this RefSeq results from translation initiation at a downstream AUG start codon. Isoform LAP2 has a shorter N-terminus, compared to isoform LAP1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.