SKP1 (NM_170679) Human Untagged Clone

CAT#: SC100696

SKP1 (untagged)-Human S-phase kinase-associated protein 1 (SKP1), transcript variant 2


  "NM_170679" in other vectors (6)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "SKP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SKP1
Synonyms EMC19; OCP-II; OCP2; p19A; SKP1A; TCEB1L
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_170679, the custom clone sequence may differ by one or more nucleotides


ATGCCTTCAATTAAGTTGCAGAGTTCTGATGGAGAGATATTTGAAGTTGATGTGGAAATTGCCAAACAAT
CTGTGACTATTAAGACCATGTTGGAAGATTTGGGAATGGATGATGAAGGAGATGATGACCCAGTTCCTCT
ACCAAATGTGAATGCAGCAATATTAAAAAAGGTCATTCAGTGGTGCACCCACCACAAGGATGACCCTCCT
CCTCCTGAAGATGATGAGAACAAAGAAAAGCGAACAGATGATATCCCTGTTTGGGACCAAGAATTCCTGA
AAGTTGACCAAGGAACACTTTTTGAACTCATTCTGGCTGCAAACTACTTAGACATCAAAGGTTTGCTTGA
TGTTACATGCAAGACTGTTGCCAATATGATCAAGGGGAAAACTCCTGAGGAGATTCGCAAGACCTTCAAT
ATCAAAAATGACTTTACTGAAGAGGAGGAAGCCCAGGTACGCAAAGAGAACCAGTGGTGTGAAGAGAAGT
GA


>OriGene 5' read for NM_170679 unedited
CTCCTATAGGGCGGCCGCGAATTCGCACGAGGGCGCTGCGACGCTGTAGTGGCTTCGTCT
TCGGTTTTTCTCTTCCTTCGCTAACGCCTCCCGGCTCTCGTCAGCCTCCCGCCGGCCGTC
TCCTTAACACCGAACACCATGCCTTCAATTAAGTTGCAGAGTTCTGATGGAGAGATATTT
GAAGTTGATGTGGAAATTGCCAAACAATCTGTGACTATTAAGACCATGTTGGAAGATTTG
GGAATGGATGATGAAGGAGATGATGACCCAGTTCCTCTACCAAATGTGAATGCAGCAATA
TTAAAAAAGGTCATTCAGTGGTGCACCCACCACAAGGATGACCCTCCTCCTCCTGAAGAT
GATGAGAACAAAGAAAAGCGAACAGATGATATCCCTGTTTGGGACCAAGAATTCCTGAAA
GTTGACCAAGGAACACTTTTTGAACTCATTCTGGCTGCAAACTACTTAGACATCAAAGGT
TTGCTTGATGTTACATGCAAGCACTGTTGCCAATATGATCAAGGGGAAAACTCCTGAGGA
GATTCGCAAGACCTTCAATAGCAAAAATGACTTTACTGAAGAGGAGGAAGCCCAGGTACG
CAAAGAGAACCAGTGGTGTGAAGAGAAGTGAAATGTTGTGCCTGACACTGTAACACTGTA
AGGATTGTTCCAAATACTAGTTGCACTGCTCTGTTTATAATTGTTAATATTAGACCAACA
GTAGACAAATGCAGCAGCAAGTCAATTGTATTAGCAGAATATTGTCCTCATTGCATGTTG
TAGTTTGAGCACAGATCCCANACCTACGGNNCAGTTTCTTCTAGTATGAGGGAAAATTNC
TTTTTTCTTTGCTCTGATAAACTGAACGGGGGGTCTCTATAAGGGNCATT
Restriction Sites NotI-NotI     
ACCN NM_170679
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_170679.1, NP_733779.1
RefSeq Size 1486 bp
RefSeq ORF 492 bp
Locus ID 6500
Cytogenetics 5q31.1
Protein Families Druggable Genome
Protein Pathways Cell cycle, Oocyte meiosis, TGF-beta signaling pathway, Ubiquitin mediated proteolysis, Wnt signaling pathway
Gene Summary 'This gene encodes a component of SCF complexes, which are composed of this protein, cullin 1, a ring-box protein, and one member of the F-box family of proteins. This protein binds directly to the F-box motif found in F-box proteins. SCF complexes are involved in the regulated ubiquitination of specific protein substrates, which targets them for degradation by the proteosome. Specific F-box proteins recognize different target protein(s), and many specific SCF substrates have been identified including regulators of cell cycle progression and development. Studies have also characterized the protein as an RNA polymerase II elongation factor. Alternative splicing of this gene results in two transcript variants. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (2) utilizes an alternate splice site in the 3' coding region, compared to variant 1. This results in a frameshift and slightly longer protein (isoform b), compared to isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.