MRPL27 (NM_148571) Human Untagged Clone

CAT#: SC101195

MRPL27 (untagged)-Human mitochondrial ribosomal protein L27 (MRPL27), nuclear gene encoding mitochondrial protein, transcript variant 2


Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "MRPL27"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MRPL27
Synonyms L27mt; L27mt, MGC23716; MGC23716; mitochondrial ribosomal protein L27
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_148571, the custom clone sequence may differ by one or more nucleotides


ATGGCGTCGGTGGTGTTGGCGCTGAGGACCCGGACAGCCGTTACATCCTTGCTAAGCCCCACTCCGGCTA
CAGCTCTTGCTGTCAGATACGCATCCAAGAAGTCGGGTGGTAGCTCCAAAAACCTCGGTGGAAAGTCATC
AGGCAGACGCCAAGGCATTAAGAAAATGGAAGGTCACTATGTTCATGCTGGGAACATCATTGCAACACAG
CGCCATTTCCGCTGGCACCCAGGTGCCCATGTGAGTTGCTCCGTTGCTGCCCCCCTTTTTCCTTTTCTAG
GTTGA


>OriGene 5' read for NM_148571 unedited
ACTGACTATGGAGTNNNNNNNNNNNNNNNAGAGGGTGATCGAAAGCTGGCGTCGGCGGTG
TTGGCGCTGAGGACCCGGACAGCCGTTACATCCTTGCTAAGCCCCACTCCGGCTACAGCT
CTTGCTGTCAGATACGCATCCAAGAAGTCGGGTGGTAGCTCCAAAAACCTCGGTGGAAAG
TCATCAGGCAGACGCCAAGGCATTAAGAAAATGGAAGGTCACTATGTTCATGCTGGGAAC
ATCATTGCAACACAGCGCCATTTCCGCTGGCACCCAGGTGCCCATGTGAGTTGCTCCGTT
GCTGCCCCCCTTTTTCCTTTTCTAGGTTGACCTCTCCTTGCCCCTAAGCATGGTAATAAC
AGTTGCATGTATTGAGTGCTTACCAAATGGCAAGCATTGTGCTGATTCCCATGCCTACAC
GATCTCATTTCTTCCTTACCACATCCCTGNAAGTAAGGTGAAATGCCANAGACCTANACG
GNGTGGAAGGAGCAAGTGACTGCTGGGATTTGCACCANGTCTGCCTAACTCCCAGATCAC
TATGATTTGCCCTGGTGTTGCATTGGCCTGGTATTCTTGGGTCTCCTTTCTAACCCTCAG
TTCTTGGAGGACAAGATACCTGGTGATTTAAAATATTATTTTAGTCTGGGAACTAAATTC
ATTATTAGTNNTCATATTCTAAGACTCTTNCTTGTATAACTACTGCAGATGGTGAANGAT
ACTTGATTAATGAATAGAATCAGTTGCCAGAGGTAGTTATACCAGTGGGATTCAGTTCAG
CAGTTGCATATTTTATGGGANGACAGTTTTGTACAAACTACGAACTGACTCTCCATATTT
AAATATAGTGCTTGNACAGTTTCCTCCCACCCTTTCATATTTATAGACAAAGGTGATAGA
CTGTTTATCAGAGCTATNGATGGAATGTTGATGAGACTTTACTTAACTACATTAAGGGGC
TTTACAATATCACTACATTGCTNAGTTTAGCCTTGATGGG
Restriction Sites NotI-NotI     
ACCN NM_148571
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_148571.1, NP_683412.1
RefSeq Size 2472 bp
RefSeq ORF 285 bp
Locus ID 51264
Cytogenetics 17q21.33
Gene Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, compared to variant 1, that results in a frameshift. It encodes isoform b which has a shorter and distinct C-terminus compared to isoform a.

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.