BEX2 (NM_032621) Human Untagged Clone

CAT#: SC104136

BEX2 (untagged)-Human brain expressed X-linked 2 (BEX2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BEX2
• Synonyms: BEX1; DJ79P11.1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_032621 edited
  CCCGGTGTCCCTGAGGACGTGCGGGCCAGGTACGGCCCCGAAAGTAGGAAGCGGAGGGGG
  AGCAGGTTTGCGGGGCCAAGTGTTGCGGCGACGCACCTCACGTCGAGAATCGGGAGGAGG
  AGACTGCAAGGATAGGCCCAGGAGTAATGGAGTCCAAAGAGGAACGAGCGTTAAACAATC
  TCATCGTGGAAAATGTCAACCAGGAAAATGATGAAAAAGATGAAAAGGAGCAAGTTGCTA
  ATAAAGGGGAGCCCTTGGCCCTACCTTTGAATGTTAGTGAATACTGTGTGCCTAGAGGAA
  ACCGTAGGCGGTTCCGCGTTAGGCAGCCCATCCTGCAGTATAGATGGGACATAATGCATA
  GGCTTGGAGAGCCACAGGCAAGGATGAGAGAGGAGAATATGGAAAGGATTGGGGAGGAGG
  TGAGACAGCTGATGGAAAAGCTGAGGGAAAAGCAGTTGAGTCATAGTTTGCGGGCAGTCA
  GCACTGATCCCCCTCACCATGACCATCACGATGAGTTTTGCCTTATGCCCTGAATCCTGA
  TGGTTTCCCTGAAGTTAATAGGGAGACCCCTGCTTCCTAAACTTACACATTTGTGGTGTA
  CCTTTGTCGTAAACGTTTTGATGTTACCTATTTCTTGTGGGTCTCCTATTACCAGCTTCT
  AAATGAATGTTGTTTTTGACCCAGTTTGTAAGTTTCTGTCAGCAGGAGAGTTTTACCTAT
  TGCATGGAAAGATGCTCATTATATATTGTGAAGTTAATAAAACAGTTTTAAAAAGCAAAA
  AAAAAAAAAAAA
  
• Restriction Sites: Please inquire
• ACCN: NM_032621
• ORF Size: 387 bp
• Insert Size: 800
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_032621.2.

Reference Data

• RefSeq: NM_032621.2, NP_116010.1
• RefSeq Size: 878
• RefSeq ORF: 387
• Locus ID: 84707
• Domains: BEX
• Gene Summary: This gene belongs to the brain expressed X-linked gene family. The encoded protein interacts with the transcription factor LIM domain only 2 in a DNA-binding complex that recognizes the E-box element and promotes transcription. This gene has been found to be a tumor suppressor that is silenced in human glioma. In breast cancer cells, this gene product modulates apoptosis in response to estrogen and tamoxifen, and enhances the anti-proliferative effect of tamoxifen. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Variants 3 and 4 encode the same isoform (3).