Caspase 4 (CASP4) (NM_033307) Human Untagged Clone

CAT#: SC107961

CASP4 (untagged)-Human caspase 4, apoptosis-related cysteine peptidase (CASP4), transcript variant delta

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CASP4
• Synonyms: apoptotic cysteine protease Mih1/TX; Caspase 4; caspase 4, apoptosis-related cysteine peptidase; caspase 4, apoptosis-related cysteine protease; ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX; TX, ICH-2, Mih1/TX, ICEREL-II, ICE(rel)II
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_033307, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCAGAAGGCAACCACAGAAAAAAGCCACTTAAGGTGTTGGAATCCCTGGGCAAAGATTTCCTCACTG
  GTGTTTTGGATAACTTGGTGGAACAAAATGTACTGAACTGGAAGGAAGAGGAAAAAAAGAAATATTACGA
  TGCTAAAACTGAAGACAAAGTTCGGGTCATGGCAGACTCTATGCAAGAGAAGCAACGTATGGCAGGACAA
  ATGCTTCTTCAAACCTTTTTTAACATAGACCAAATATCCCCCAATAAAAAAGGTGATAAATTGGGTCACA
  GAGGCAGAAATCACAATTTATGTTCTGCAATATCCTGCAGCTCATCCGAATATGGAGGCTGGACCACCTG
  A
  
  
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_033307 unedited
  GACTNTCGCATTAGGAAGACAGATTTTGTTCCCTATGGCAGGCAACCACAGCAAAAAAGC
  CACTTAAGGTGTTGGAATCCCTGGGCAAAGATTTCCTCACTGGTGTTTTGGATAACTTGG
  TGGAACAAAATGTACTGAACTGGAAGGAAGAGGAAAAAAAGAAATATTACGATGCTAAAT
  CNGAGACAAAGTTTGGGTCATGGTAGACTCTATGCAAGAGAAGCAACGTATGGCAGGACA
  AATGCTTCTTCAAACCTTTTTTAACATAGACCAAATATCCCCCAATAAAAAAGCTCATCC
  GAATATGGAGGCTGGACCACCTGAGTCAGGAGAATCTACAGATGCCCTCAAGCTTTGTCC
  TCATGAAGAATTCCTGAGACTATGTAAAGAAAGAGCTGAAGAGATCTATCCAATAAAGGA
  GAGAAACAACCGCACACGCCTGGCTCTCATCATATGCAATACAGAGTTTGACCATCTGCC
  TCCGAGGAATGGAGCTGACTTTGACATCACAGGGATGAAGGAGCTACTTGAGGGTCTGGA
  CTATAGTGTAGATGTAGAAGAGAATCTGACAGCCAGGGATATGGAGTCAGCGCTGAGGGC
  ATTTGCTACCAGACCAGAGCACAAGTCCTCTGACAGCACATTCTTGGTACTCAATTCTCA
  TGGCATCCTGGAAGGAATCTGCGGAACTGTGCATGATGAGAAAAAAACCAGATGTGCCTG
  CTTATGACACCATCTTCCAGATATTTCACAACCGCAACCTGCCTCAGTCTGAAGGACAAA
  CCCCAAGGTCTTATTGTCCAGGCCTGCAGAGTTGCAAACCGTGGGGAACTGTGGGTCAGA
  GACTCTCCAGCATCCTTGAAAGTGGCCTTCTCACAGTCATCTG
  
• Restriction Sites: NotI-NotI
• ACCN: NM_033307
• Insert Size: 1320 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_033307.2, NP_150650.2
• RefSeq Size: 1327 bp
• RefSeq ORF: 351 bp
• Locus ID: 837
• Cytogenetics: 11q22.3
• Domains: Peptidase_C14
• Protein Families: Druggable Genome, Protease
• Gene Summary: 'This gene encodes a protein that is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes composed of a prodomain and a large and small protease subunit. Activation of caspases requires proteolytic processing at conserved internal aspartic residues to generate a heterodimeric enzyme consisting of the large and small subunits. This caspase is able to cleave and activate its own precursor protein, as well as caspase 1 precursor. When overexpressed, this gene induces cell apoptosis. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (delta) contains a unique internal fragment absent in variant alpha, which leads to a translation frameshift. Two polypeptides are produced from this variant. One corresponds to the N-terminal portion of isoform alpha and has a distinct C-terminus; another is identical to the N-terminal truncated isoform alpha.