Caspase 10 (CASP10) (NM_001230) Human Untagged Clone

CAT#: SC109030

CASP10 (untagged)-Human caspase 10, apoptosis-related cysteine peptidase (CASP10), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CASP10
• Synonyms: ALPS2; FLICE2; MCH4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001230, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAATCTCAAGGTCAACATTGGTATTCCAGTTCAGATAAAAACTGTAAAGTGAGCTTTCGTGAGAAGC
  TTCTGATTATTGATTCAAACCTGGGGGTCCAAGATGTGGAGAACCTCAAGTTTCTCTGCATAGGATTGGT
  CCCCAACAAGAAGCTGGAGAAGTCCAGCTCAGCCTCAGATGTTTTTGAACATCTCTTGGCAGAGGATCTG
  CTGAGTGAGGAAGACCCTTTCTTCCTGGCAGAACTCCTCTATATCATACGGCAGAAGAAGCTGCTGCAGC
  ACCTCAACTGTACCAAAGAGGAAGTGGAGCGACTGCTGCCCACCCGACAAAGGGTTTCTCTGTTTAGAAA
  CCTGCTCTACGAACTGTCAGAAGGCATTGACTCAGAGAACTTAAAGGACATGATCTTCCTTCTGAAAGAC
  TCGCTTCCCAAAACTGAAATGACCTCCCTAAGTTTCCTGGCATTTCTAGAGAAACAAGGTAAAATAGATG
  AAGATAATCTGACATGCCTGGAGGACCTCTGCAAAACAGTTGTACCTAAACTTTTGAGAAACATAGAGAA
  ATACAAAAGAGAGAAAGCTATCCAGATAGTGACACCTCCTGTAGACAAGGAAGCCGAGTCGTATCAAGGA
  GAGGAAGAACTAGTTTCCCAAACAGATGTTAAGACATTCTTGGAAGCCTTACCGAGGGCAGCTGTGTACA
  GGATGAATCGGAACCACAGAGGCCTCTGTGTCATTGTCAACAACCACAGCTTTACCTCCCTGAAGGACAG
  ACAAGGAACCCATAAAGATGCTGAGATCCTGAGTCATGTGTTCCAGTGGCTTGGGTTCACAGTGCATATA
  CACAATAATGTGACGAAAGTGGAAATGGAGATGGTCCTGCAGAAGCAGAAGTGCAATCCAGCCCATGCCG
  ACGGGGACTGCTTCGTGTTCTGTATTCTGACCCATGGGAGATTTGGAGCTGTCTACTCTTCGGATGAGGC
  CCTCATTCCCATTCGGGAGATCATGTCTCACTTCACAGCCCTGCAGTGCCCTAGACTGGCTGAAAAACCT
  AAACTCTTTTTCATCCAGGCCTGCCAAGGTGAAGAGATACAGCCTTCCGTATCCATCGAAGCAGATGCTC
  TGAACCCTGAGCAGGCACCCACTTCCCTGCAGGACAGTATTCCTGCCGAGGCTGACTTCCTACTTGGTCT
  GGCCACTGTCCCAGGCTATGTATCCTTTCGGCATGTGGAGGAAGGCAGCTGGTATATTCAGTCTCTGTGT
  AATCATCTGAAGAAATTGGTCCCAAGACATGAAGACATCTTATCCATCCTCACTGCTGTCAACGATGATG
  TGAGTCGAAGAGTGGACAAACAGGGAACAAAGAAACAGATGCCCCAGCCTGCTTTCACACTAAGGAAAAA
  ACTAGTATTCCCTGTGCCCCTGGATGCACTTTCATTATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001230
• Insert Size: 4110 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001230.4, NP_001221.2
• RefSeq Size: 5777 bp
• RefSeq ORF: 1440 bp
• Locus ID: 843
• Cytogenetics: 2q33.1
• Domains: Peptidase_C14, DED, CASc
• Protein Families: Druggable Genome, Protease
• Protein Pathways: Apoptosis, RIG-I-like receptor signaling pathway
• Gene Summary: 'This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein cleaves and activates caspases 3 and 7, and the protein itself is processed by caspase 8. Mutations in this gene are associated with type IIA autoimmune lymphoproliferative syndrome, non-Hodgkin lymphoma and gastric cancer. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2011]'
  Transcript Variant: This variant (3) lacks two in-frame coding exons compared to variant 1. This results in a shorter isoform (3, also known as Mch4 and caspase-10/a) missing an internal protein segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.