hnRNP A1 (HNRNPA1) (NM_031157) Human Untagged Clone

CAT#: SC109309

HNRNPA1 (untagged)-Human heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HNRNPA1
• Synonyms: ALS19; ALS20; hnRNP-A1; hnRNP A1; HNRPA1; HNRPA1L3; IBMPFD3; UP 1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_031157 edited
  TTCACCCTGCCGTCATGTCTAAGTCAGAGTCTCCTAAAGAGCCCGAACAGCTGAGGAAGC
  TCTTCATTGGAGGGTTGAGCTTTGAAACAACTGATGAGAGCCTGAGGAGCCATTTTGAGC
  AATGGGGAACGCTCACGGACTGTGTGGTAATGAGAGATCCAAACACCAAGCGCTCCAGGG
  GCTTTGGGTTTGTCACATATGCCACTGTGGAGGAGGTGGATGCAGCTATGAATGCAAGGC
  CACACAAGGTGGATGGAAGAGTTGTGGAACCAAAGAGAGCTGTCTCCAGAGAAGATTCTC
  AAAGACCAGGTGCCCACTTAACTGTGAAAAAGATATTTGTTGGTGGCATTAAAGAAGACA
  CTGAAGAACATCACCTAAGAGATTATTTTGAACAGTATGGAAAAATTGAAGTGATTGAAA
  TCATGACTGACCGAGGCAGTGGCAAGAAAAGGGGCTTTGCCTTTGTAACCTTTGACGACC
  ATGACTCCGTGGATAAGATTGTCATTCAGAAATACCATACTGTGAATGGCCACAACTGTG
  AAGTTAGAAAAGCCCTGTCAAAGCAAGAGATGGCTAGTGCTTCATCCAGCCAAAGAGGTC
  GAAGTGGTTCTGGAAACTTTGGTGGTGGTCGTGGAGGTGGTTTCGGTGGGAATGACAACT
  TCGGTCGTGGAGGAAACTTCAGTGGTCGTGGTGGCTTTGGTGGCAGCCGTGGTGGTGGTG
  GATATGGTGGCAGTGGGGATGGCTATAATGGATTTGGTAATGATGGTGGTTATGGAGGAG
  GCGGCCCTGGTTACTCTGGAGGAAGCAGAGGCTATGGAAGTGGTGGACAGGGTTATGGAA
  ACCAGGGCAGTGGCTATGGCGGGAGTGGCAGCTATGACAGCTATAACAACGGAGGCGGAG
  GCGGCTTTGGCGGTGGTAGTGGAAGCAATTTTGGAGGTGGTGGAAGCTACAATGATTTTG
  GGAATTACAACAATCAGTCTTCAAATTTTGGACCCATGAAGGGAGGAAATTTTGGAGGCA
  GAAGCTCTGGCCCCTATGGCGGTGGAGGCCAATACTTTGCAAAACCACGAAACCAAGGTG
  GCTATGGCGGTTTCAGCAGCAGCAGTAGCTATGGCAGTGGCAGAAGATTTTAATTAGGAA
  ACAAAGCTT
  
• Restriction Sites: Please inquire
• ACCN: NM_031157
• Insert Size: 1200 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_031157.1.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_031157.1, NP_112420.1
• RefSeq Size: 1925 bp
• RefSeq ORF: 1119 bp
• Locus ID: 3178
• Cytogenetics: 12q13.13
• Domains: RRM
• Protein Pathways: Spliceosome
• Gene Summary: 'This gene encodes a member of a family of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs), which are RNA-binding proteins that associate with pre-mRNAs in the nucleus and influence pre-mRNA processing, as well as other aspects of mRNA metabolism and transport. The protein encoded by this gene is one of the most abundant core proteins of hnRNP complexes and plays a key role in the regulation of alternative splicing. Mutations in this gene have been observed in individuals with amyotrophic lateral sclerosis 20. Multiple alternatively spliced transcript variants have been found. There are numerous pseudogenes of this gene distributed throughout the genome. [provided by RefSeq, Feb 2016]'
  Transcript Variant: This variant (2, also known as A1B) contains an alternate in-frame exon compared to variant 1, resulting in a longer protein (isoform b) than isoform 1.