MBD2 (NM_015832) Human Untagged Clone

CAT#: SC110013

MBD2 (untagged)-Human methyl-CpG binding domain protein 2 (MBD2), transcript variant 2


  "NM_015832" in other vectors (3)

Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "MBD2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MBD2
Synonyms DMTase; NY-CO-41
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_015832 edited
GCGCGCCGCGCTGCGGGCGGGGCGGGTCTCCGGGATTCCAAGGGCTCGGTTACGGAAGAA
GCGCAGCGCCGGCTGGGGAGGGGGCTGGATGCGCGCGCACCCGGGGGGAGGCCGCTGCTG
CCCGGAGCAGGAGGAGGGGGAGAGTGCGGCGGGCGGCAGCGGCGCTGGCGGCGACTCCGC
CATAGAGCAGGGGGGCCAGGGCAGCGCGCTCGCCCCGTCCCCGGTGAGCGGCGTGCGCAG
GGAAGGCGCTCGGGGCGGCGGCCGTGGCCGGGGGCGGTGGAAGCAGGCGGGCCGGGGCGG
CGGCGTCTGTGGCCGTGGCCGGGGCCGGGGCCGTGGCCGGGGACGGGGACGGGGCCGGGG
CCGGGGCCGCGGCCGTCCCCCGAGTGGCGGCAGCGGCCTTGGCGGCGACGGCGGCGGCTG
CGGCGGCGGCGGCAGCGGTGGCGGCGGCGCCCCCCGGCGGGAGCCGGTCCCTTTCCCGTC
GGGGAGCGCGGGGCCGGGGCCCAGGGGACCCCGGGCCACGGAGAGCGGGAAGAGGATGGA
TTGCCCGGCCCTCCCCCCCGGATGGAAGAAGGAGGAAGTGATCCGAAAATCTGGGCTAAG
TGCTGGCAAGAGCGATGTCTACTACTTCAGTCCAAGTGGTAAGAAGTTCAGAAGCAAGCC
TCAGTTGGCAAGGTACCTGGGAAATACTGTTGATCTCAGCAGTTTTGACTTCAGAACTGG
AAAGATGATGCCTAGTAAATTACAGAAGAACAAACAGAGACTGCGAAACGATCCTCTCAA
TCAAAATAAGCTGCGCTGGAACACTCATCGTCCTGCACCATGGCATGCGCTTTCAAGACT
CTGCTTGCTCATACGCTGTTTGCTCTGCTTGGAATGTGCTTACCCCCTTCCCCTTCATCT
GGTGAACTCCTACTCATCCAAGACCCAGCTTCATTGTCTCCATCTCTGGGAAGCCTGCCC
TGCATACTCCAGGCAGAACCAATCCTTTCCTCCATAATCTAGA
Restriction Sites NotI-NotI     
ACCN NM_015832
ORF Size 909 bp
Insert Size 1000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_015832.3.
Reference Data
RefSeq NM_015832.3, NP_056647.1
RefSeq Size 1357
RefSeq ORF 909
Locus ID 8932
Domains MBD
Protein Families Druggable Genome, Stem cell - Pluripotency, Transcription Factors
Gene Summary DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. The protein encoded by this gene may function as a mediator of the biological consequences of the methylation signal. It is also reported that the this protein functions as a demethylase to activate transcription, as DNA methylation causes gene silencing. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (2) includes an alternate exon in the 3' coding region, compared to variant 1, resulting in a shorter protein (testis-specific) that has a shorter C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.