ELOVL6 (NM_024090) Human Untagged Clone

CAT#: SC111410

ELOVL6 (untagged)-Human ELOVL fatty acid elongase 6 (ELOVL6), transcript variant 1


  "NM_024090" in other vectors (6)

Reconstitution Protocol

USD 540.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "ELOVL6"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ELOVL6
Synonyms FACE; FAE; LCE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_024090, the custom clone sequence may differ by one or more nucleotides


ATGAACATGTCAGTGTTGACTTTACAAGAATATGAATTCGAAAAGCAGTTCAACGAGAATGAAGCCATCC
AATGGATGCAGGAAAACTGGAAGAAATCTTTCCTGTTTTCTGCTCTGTATGCTGCCTTTATATTCGGTGG
TCGGCACCTAATGAATAAACGAGCAAAGTTTGAACTGAGGAAGCCATTAGTGCTCTGGTCTCTGACCCTT
GCAGTCTTCAGTATATTCGGTGCTCTTCGAACTGGTGCTTATATGGTGTACATTTTGATGACCAAAGGCC
TGAAGCAGTCAGTTTGTGACCAGGGTTTTTACAATGGACCTGTCAGCAAATTCTGGGCTTATGCATTTGT
GCTAAGCAAAGCACCCGAACTAGGAGATACAATATTCATTATTCTGAGGAAGCAGAAGCTGATCTTCCTG
CACTGGTATCACCACATCACTGTGCTCCTGTACTCTTGGTACTCCTACAAAGACATGGTTGCCGGGGGAG
GTTGGTTCATGACTATGAACTATGGCGTGCACGCCGTGATGTACTCTTACTATGCCTTGCGGGCGGCAGG
TTTCCGAGTCTCCCGGAAGTTTGCCATGTTCATCACCTTGTCCCAGATCACTCAGATGCTGATGGGCTGT
GTGGTTAACTACCTGGTCTTCTGCTGGATGCAGCATGACCAGTGTCACTCTCACTTTCAGAACATCTTCT
GGTCCTCACTCATGTACCTCAGCTACCTTGTGCTCTTCTGCCATTTCTTCTTTGAGGCCTACATCGGCAA
AATGAGGAAAACAACGAAAGCTGAATAG


Restriction Sites SgfI-MluI     
ACCN NM_024090
ORF Size 798 bp
Insert Size 3000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_024090.2, NP_076995.1
RefSeq Size 3392
RefSeq ORF 798
Locus ID 79071
Domains ELO
Protein Families Transmembrane
Protein Pathways Biosynthesis of unsaturated fatty acids
Gene Summary Fatty acid elongases (EC 6.2.1.3), such as ELOVL6, use malonyl-CoA as a 2-carbon donor in the first and rate-limiting step of fatty acid elongation (Moon et al., 2001 [PubMed 11567032]). [supplied by OMIM, Mar 2008]
Transcript Variant: This variant (1) represents the longer transcript.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.