GALT (NM_000155) Human Untagged Clone

CAT#: SC111633

GALT (untagged)-Human galactose-1-phosphate uridylyltransferase (GALT)


  "NM_000155" in other vectors (4)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "GALT"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GALT
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_000155, the custom clone sequence may differ by one or more nucleotides


ATGTCGCGCAGTGGAACCGATCCTCAGCAACGCCAGCAGGCGTCAGAGGCGGACGCCGCAGCAGCAACCT
TCCGGGCAAACGACCATCAGCATATCCGCTACAACCCGCTGCAGGATGAGTGGGTGCTGGTGTCAGCTCA
CCGCATGAAGCGGCCCTGGCAGGGTCAAGTGGAGCCCCAGCTTCTGAAGACAGTGCCCCGCCATGACCCT
CTCAACCCTCTGTGTCCTGGGGCCATCCGAGCCAACGGAGAGGTGAATCCCCAGTACGATAGCACCTTCC
TGTTTGACAACGACTTCCCAGCTCTGCAGCCTGATGCCCCCAGTCCAGGACCCAGTGATCATCCCCTTTT
CCAAGCAAAGTCTGCTCGAGGAGTCTGTAAGGTCATGTGCTTCCACCCCTGGTCGGATGTAACGCTGCCA
CTCATGTCGGTCCCTGAGATCCGGGCTGTTGTTGATGCATGGGCCTCAGTCACAGAGGAGCTGGGTGCCC
AGTACCCTTGGGTGCAGATCTTTGAAAACAAAGGTGCCATGATGGGCTGTTCTAACCCCCACCCCCACTG
CCAGGTATGGGCCAGCAGTTTCCTGCCAGATATTGCCCAGCGTGAGGAGCGATCTCAGCAGGCCTATAAG
AGTCAGCATGGAGAGCCCCTGCTAATGGAGTACAGCCGCCAGGAGCTACTCAGGAAGGAACGTCTGGTCC
TAACCAGTGAGCACTGGTTAGTACTGGTCCCCTTCTGGGCAACATGGCCCTACCAGACACTGCTGCTGCC
CCGTCGGCATGTGCGGCGGCTACCTGAGCTGACCCCTGCTGAGCGTGATGATCTAGCCTCCATCATGAAG
AAGCTCTTGACCAAGTATGACAACCTCTTTGAGACGTCCTTTCCCTACTCCATGGGCTGGCATGGGGCTC
CCACAGGATCAGAGGCTGGGGCCAACTGGAACCATTGGCAGCTGCACGCTCATTACTACCCTCCGCTCCT
GCGCTCTGCCACTGTCCGGAAATTCATGGTTGGCTACGAAATGCTTGCTCAGGCTCAGAGGGACCTCACC
CCTGAGCAGGCTGCAGAGAGACTAAGGGCACTTCCTGAGGTTCATTACCACCTGGGGCAGAAGGACAGGG
AGACAGCAACCATCGCCTGA


Restriction Sites NotI-NotI     
ACCN NM_000155
Insert Size 2480 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000155.3, NP_000146.2
RefSeq Size 1407 bp
RefSeq ORF 1140 bp
Locus ID 2592
Cytogenetics 9p13.3
Domains GalP_UDP_transf, GalP_UDP_tr_C
Protein Families Druggable Genome
Protein Pathways Amino sugar and nucleotide sugar metabolism, Galactose metabolism, Metabolic pathways
Gene Summary 'Galactose-1-phosphate uridyl transferase (GALT) catalyzes the second step of the Leloir pathway of galactose metabolism, namely the conversion of UDP-glucose + galactose-1-phosphate to glucose-1-phosphate + UDP-galactose. The absence of this enzyme results in classic galactosemia in humans and can be fatal in the newborn period if lactose is not removed from the diet. The pathophysiology of galactosemia has not been clearly defined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]'
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.