MAX (NM_002382) Human Untagged Clone

CAT#: SC111653

MAX (untagged)-Human MYC associated factor X (MAX), transcript variant 1


  "NM_002382" in other vectors (6)

Reconstitution Protocol

USD 540.00

In Stock*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MAX
Synonyms bHLHd4
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_002382 edited
ATGAGCGATAACGATGACATCGAGGTGGAGAGCGACGAAGAGCAACCGAGGTTTCAATCT
GCGGCTGACAAACGGGCTCATCATAATGCACTGGAACGAAAACGTAGGGACCACATCAAA
GACAGCTTTCACAGTTTGCGGGACTCAGTCCCATCACTCCAAGGAGAGAAGGCATCCCGG
GCCCAAATCCTAGACAAAGCCACAGAATATATCCAGTATATGCGAAGGAAAAACCACACA
CACCAGCAAGATATTGACGACCTCAAGCGGCAGAATGCTCTTCTGGAGCAGCAAGTCCGT
GCACTGGAGAAGGCGAGGTCAAGTGCCCAACTGCAGACCAACTACCCCTCCTCAGACAAC
AGCCTCTACACCAACGCCAAGGGCAGCACCATCTCTGCCTTCGATGGGGGCTCGGACTCC
AGCTCGGAGTCTGAGCCTGAAGAGCCCCAAAGCAGGAAGAAGCTCCGGATGGAGGCCAGC
TAA
Restriction Sites NotI-NotI     
ACCN NM_002382
Insert Size 2100 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation no
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002382.3, NP_002373.3
RefSeq Size 2068 bp
RefSeq ORF 483 bp
Locus ID 4149
Cytogenetics 14q23.3
Domains HLH
Protein Families Druggable Genome, Transcription Factors
Protein Pathways MAPK signaling pathway, Pathways in cancer, Small cell lung cancer
Gene Summary 'The protein encoded by this gene is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell proliferation, differentiation and apoptosis. The homodimers and heterodimers compete for a common DNA target site (the E box) and rearrangement among these dimer forms provides a complex system of transcriptional regulation. Mutations of this gene have been reported to be associated with hereditary pheochromocytoma. A pseudogene of this gene is located on the long arm of chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]'
Transcript Variant: This variant (1) encodes the longest isoform (a) which is also known as the long form.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.