Acid Phosphatase (ACP1) (NM_004300) Human Untagged Clone

CAT#: SC111923

ACP1 (untagged)-Human acid phosphatase 1, soluble (ACP1), transcript variant 3


  "NM_004300" in other vectors (6)

Reconstitution Protocol

SC111923 is the updated version of SC127966.

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "ACP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ACP1
Synonyms HAAP; LMW-PTP; LMWPTP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC111923 sequence for NM_004300 edited (data generated by NextGen Sequencing)
ATGGCGGAACAGGCTACCAAGTCCGTGCTGTTTGTGTGTCTGGGTAACATTTGTCGATCA
CCCATTGCAGAAGCAGTTTTCAGGAAACTTGTAACCGATCAAAACATCTCAGAGAATTGG
AGGGTAGACAGCGCGGCAACTTCCGGGTATGAGATAGGGAACCCCCCTGACTACCGAGGG
CAGAGCTGCATGAAGAGGCACGGCATTCCCATGAGCCACGTTGCCCGGCAGATTACCAAA
GAAGATTTTGCCACATTTGATTATATACTATGTATGGATGAAAGCAATCTGAGAGATTTG
AATAGAAAAAGTAATCGAGTTAAAACCTGCAAAGCTAAAATTGAACTACTTGGGAGCTAT
GATCCACAAAAACAACTTATTATTGAAGATCCCTATTATGGGAATGACTCTGACTTTGAG
ACGGTGTACCAGCAGTGTGTCAGGTGCTGCAGAGCGTTCTTGGAGAAGGCCCACTGA

Clone variation with respect to NM_004300.3
317 a=>g
Restriction Sites NotI-NotI     
ACCN NM_004300
Insert Size 1570 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004300.2, NP_004291.1
RefSeq Size 1549 bp
RefSeq ORF 477 bp
Locus ID 52
Cytogenetics 2p25.3
Domains LMWPc
Protein Families Druggable Genome, Phosphatase, Transmembrane
Protein Pathways Adherens junction, Riboflavin metabolism
Gene Summary 'The product of this gene belongs to the phosphotyrosine protein phosphatase family of proteins. It functions as an acid phosphatase and a protein tyrosine phosphatase by hydrolyzing protein tyrosine phosphate to protein tyrosine and orthophosphate. This enzyme also hydrolyzes orthophosphoric monoesters to alcohol and orthophosphate. This gene is genetically polymorphic, and three common alleles segregating at the corresponding locus give rise to six phenotypes. Each allele appears to encode at least two electrophoretically different isozymes, Bf and Bs, which are produced in allele-specific ratios. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Aug 2008]'
Transcript Variant: This variant (3) has multiple differences in the coding region, compared to variant 4. The resulting protein (isoform c, also known as Bf) has a distinct C-terminus and is longer than isoform d. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.