FGFR2 (NM_000141) Human Untagged Clone
CAT#: SC111932
FGFR2 (untagged)-Human fibroblast growth factor receptor 2 (FGFR2), transcript variant 1
"NM_000141" in other vectors (8)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | FGFR2 |
| Synonyms | BBDS; BEK; BFR-1; CD332; CEK3; CFD1; ECT1; JWS; K-SAM; KGFR; TK14; TK25 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_000141, the custom clone sequence may differ by one or more nucleotides
ATGGTCAGCTGGGGTCGTTTCATCTGCCTGGTCGTGGTCACCATGGCAACCTTGTCCCTGGCCCGGCCCT CCTTCAGTTTAGTTGAGGATACCACATTAGAGCCAGAAGAGCCACCAACCAAATACCAAATCTCTCAACC AGAAGTGTACGTGGCTGCGCCAGGGGAGTCGCTAGAGGTGCGCTGCCTGTTGAAAGATGCCGCCGTGATC AGTTGGACTAAGGATGGGGTGCACTTGGGGCCCAACAATAGGACAGTGCTTATTGGGGAGTACTTGCAGA TAAAGGGCGCCACGCCTAGAGACTCCGGCCTCTATGCTTGTACTGCCAGTAGGACTGTAGACAGTGAAAC TTGGTACTTCATGGTGAATGTCACAGATGCCATCTCATCCGGAGATGATGAGGATGACACCGATGGTGCG GAAGATTTTGTCAGTGAGAACAGTAACAACAAGAGAGCACCATACTGGACCAACACAGAAAAGATGGAAA AGCGGCTCCATGCTGTGCCTGCGGCCAACACTGTCAAGTTTCGCTGCCCAGCCGGGGGGAACCCAATGCC AACCATGCGGTGGCTGAAAAACGGGAAGGAGTTTAAGCAGGAGCATCGCATTGGAGGCTACAAGGTACGA AACCAGCACTGGAGCCTCATTATGGAAAGTGTGGTCCCATCTGACAAGGGAAATTATACCTGTGTAGTGG AGAATGAATACGGGTCCATCAATCACACGTACCACCTGGATGTTGTGGAGCGATCGCCTCACCGGCCCAT CCTCCAAGCCGGACTGCCGGCAAATGCCTCCACAGTGGTCGGAGGAGACGTAGAGTTTGTCTGCAAGGTT TACAGTGATGCCCAGCCCCACATCCAGTGGATCAAGCACGTGGAAAAGAACGGCAGTAAATACGGGCCCG ACGGGCTGCCCTACCTCAAGGTTCTCAAGGCCGCCGGTGTTAACACCACGGACAAAGAGATTGAGGTTCT CTATATTCGGAATGTAACTTTTGAGGACGCTGGGGAATATACGTGCTTGGCGGGTAATTCTATTGGGATA TCCTTTCACTCTGCATGGTTGACAGTTCTGCCAGCGCCTGGAAGAGAAAAGGAGATTACAGCTTCCCCAG ACTACCTGGAGATAGCCATTTACTGCATAGGGGTCTTCTTAATCGCCTGTATGGTGGTAACAGTCATCCT GTGCCGAATGAAGAACACGACCAAGAAGCCAGACTTCAGCAGCCAGCCGGCTGTGCACAAGCTGACCAAA CGTATCCCCCTGCGGAGACAGGTAACAGTTTCGGCTGAGTCCAGCTCCTCCATGAACTCCAACACCCCGC TGGTGAGGATAACAACACGCCTCTCTTCAACGGCAGACACCCCCATGCTGGCAGGGGTCTCCGAGTATGA ACTTCCAGAGGACCCAAAATGGGAGTTTCCAAGAGATAAGCTGACACTGGGCAAGCCCCTGGGAGAAGGT TGCTTTGGGCAAGTGGTCATGGCGGAAGCAGTGGGAATTGACAAAGACAAGCCCAAGGAGGCGGTCACCG TGGCCGTGAAGATGTTGAAAGATGATGCCACAGAGAAAGACCTTTCTGATCTGGTGTCAGAGATGGAGAT GATGAAGATGATTGGGAAACACAAGAATATCATAAATCTTCTTGGAGCCTGCACACAGGATGGGCCTCTC TATGTCATAGTTGAGTATGCCTCTAAAGGCAACCTCCGAGAATACCTCCGAGCCCGGAGGCCACCCGGGA TGGAGTACTCCTATGACATTAACCGTGTTCCTGAGGAGCAGATGACCTTCAAGGACTTGGTGTCATGCAC CTACCAGCTGGCCAGAGGCATGGAGTACTTGGCTTCCCAAAAATGTATTCATCGAGATTTAGCAGCCAGA AATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATA TAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGA TAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGG GGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATA AGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAG ACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAGGAATACTTG GACCTCAGCCAACCTCTCGAACAGTATTCACCTAGTTACCCTGACACAAGAAGTTCTTGTTCTTCAGGAG ATGATTCTGTTTTTTCTCCAGACCCCATGCCTTACGAACCATGCCTTCCTCAGTATCCACACATAAACGG CAGTGTTAAAACATGA |
| Restriction Sites | AscI-MluI |
| ACCN | NM_000141 |
| Insert Size | 3890 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_000141.4, NP_000132.3 |
| RefSeq Size | 4654 bp |
| RefSeq ORF | 2466 bp |
| Locus ID | 2263 |
| Cytogenetics | 10q26.13 |
| Domains | pkinase, TyrKc, S_TKc, ig, IGc2, IG |
| Protein Families | Druggable Genome, Protein Kinase, Secreted Protein, Transmembrane |
| Protein Pathways | Endocytosis, MAPK signaling pathway, Pathways in cancer, Prostate cancer, Regulation of actin cytoskeleton |
| Gene Summary | 'The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member is a high-affinity receptor for acidic, basic and/or keratinocyte growth factor, depending on the isoform. Mutations in this gene are associated with Crouzon syndrome, Pfeiffer syndrome, Craniosynostosis, Apert syndrome, Jackson-Weiss syndrome, Beare-Stevenson cutis gyrata syndrome, Saethre-Chotzen syndrome, and syndromic craniosynostosis. Multiple alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2009]' Transcript Variant: This variant (1) encodes isoform 1, also referred to as isoform BEK and K-sam. Sequence Note: A downstream AUG translation start codon is selected for this RefSeq based on the presence of a strong Kozak consensus signal, a strong community standard for the use of the downstream start codon, and on a higher probability of an N-terminal signal peptide being present in the resulting protein. The use of an alternative in-frame upstream AUG start codon would result in a protein that is 19 aa longer at the N-terminus. Translation from the annotated downstream start codon is likely to occur via leaky scanning and/or reinitiation. CCDS Note: A downstream AUG translation start codon is selected for this CCDS representation based on a strong community standard for its use, and on a higher probability of a signal peptide being present in the protein N-terminus. The use of an alternative upstream AUG start codon would result in a protein that is 19 aa longer at the N-terminus. The upstream AUG has a weak Kozak signal while the downstream AUG has a strong Kozak signal. Due to leaky scanning by ribosomes, it is possible that some ribosomes may initiate translation from the downstream AUG codon while others start from the upstream AUG. The presence of multiple upstream ORFs suggests that a combination of leaky scanning and translational reinitiation may be necessary to achieve translation of the annotated ORF. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| SC323640 | FGFR2 (untagged)-Kinase deficient mutant (K535M) of Human fibroblast growth factor receptor 2 (FGFR2), transcript variant 1 |
USD 1,660.00 |
|
| RC217098 | FGFR2 (Myc-DDK-tagged)-Human fibroblast growth factor receptor 2 (FGFR2), transcript variant 1 |
USD 1,127.00 |
|
| RC600021 | FGFR2 (DDK-His-tagged)-Extra Cellular Domain Clone of Homo sapiens fibroblast growth factor receptor 2, transcript variant 1, Signal peptide (1-21) plus EC domain (22-377) |
USD 450.00 |
|
| RG217098 | FGFR2 (GFP-tagged) - Human fibroblast growth factor receptor 2 (FGFR2), transcript variant 1 |
USD 670.00 |
|
| RC217098L1 | Lenti-ORF clone of FGFR2 (Myc-DDK-tagged)-Human fibroblast growth factor receptor 2 (FGFR2), transcript variant 1 |
USD 810.00 |
|
| RC217098L2 | Lenti-ORF clone of FGFR2 (mGFP-tagged)-Human fibroblast growth factor receptor 2 (FGFR2), transcript variant 1 |
USD 810.00 |
|
| RC217098L3 | Lenti-ORF clone of FGFR2 (Myc-DDK-tagged)-Human fibroblast growth factor receptor 2 (FGFR2), transcript variant 1 |
USD 810.00 |
|
| RC217098L4 | Lenti-ORF clone of FGFR2 (mGFP-tagged)-Human fibroblast growth factor receptor 2 (FGFR2), transcript variant 1 |
USD 810.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China